Rh5AG437600

Domain of unknown function (DUF4220)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
OG0000618
Physical Location & Seq
Reverse (-)
75180737 .. 75194567
13831 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG437600.1

Sequence Viewer

Length: 210 bp
ATGGATCAAGATTCTGTTCCAAGTCTAGGAGTGATTGTAGGATCGAGTTGTGAAGTATGGATAGAGATGTTGTGTTACTCAGCAAGCCAATGTGGATGGAAGGAGCATGTTCAACAACTTAGGCGTGGCAGAGAGTTTCTTACTCTTGTCAGCCTTCTTATGGCAAATCTTGGATTTAGTGAACAATTTCAGCAATTCATACAAGAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4220 DUF594

Protein Analysis

69

Amino Acids

7.88

Weight (kDa)

4.7

Isoelectric Point (pI)

58.26

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF594 PF04578 18 - 58 7.1e-17 Protein of unknown function, DUF594
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000618)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g04580 FvH4_3g37050 FvH4_3g37060 FvH4_4g30270 FvH4_6g34780 FvH4_6g34780
malus_domestica MD11G1092500.v1.1 MD17G1025500.v1.1
prunus_persica Prupe.1G206300_v2.0.a1 Prupe.3G040700_v2.0.a1 Prupe.3G040900_v2.0.a1 Prupe.3G041300_v2.0.a1 Prupe.3G041600_v2.0.a1 Prupe.3G061600_v2.0.a1 Prupe.4G109300_v2.0.a1 Prupe.6G069600_v2.0.a1 Prupe.6G069800_v2.0.a1 Prupe.6G069800_v2.0.a1 Prupe.6G069800_v2.0.a1 Prupe.8G014800_v2.0.a1 Prupe.8G037600_v2.0.a1
pyrus_communis pycom09g10050 pycom17g16040
rosa_chinensis RchiOBHm_Chr2g0145601 RchiOBHm_Chr5g0066461 RchiOBHm_Chr5g0066471 RchiOBHm_Chr5g0066481
rosa_laevigata RLG00000019691 RLG00000020148 RLG00000020153 RLG00000035869 RLG00000035878 RLG00000035880
rosa_multiflora Rmu_co8287763.1_g000001 Rmu_co8480723.1_g000001 Rmu_co8493537.1_g000001 Rmu_sc0002170.1_g000044 Rmu_sc0002599.1_g000001 Rmu_sc0002718.1_g000013 Rmu_sc0003046.1_g000008 Rmu_sc0007761.1_g000002
rosa_roxburghii Rroxscaffold_152G00434590 Rroxscaffold_1G00014400 Rroxscaffold_1G00014410 Rroxscaffold_1G00014570 Rroxscaffold_2G00100650 Rroxscaffold_2G00106640
rosa_rugosa Rorug02G0392200 Rorug02G0392400 Rorug05G0378500 Rorug05G0378500 Rorug05G0378500
rosa_samantha Rh2AG446400 Rh2AG446500 Rh2BG457100 Rh2BG457200 Rh2BG457300 Rh2BG458200 Rh2CG432200 Rh2CG433100 Rh2CG433200 Rh2DG466800 Rh2DG466900 Rh2DG467000 Rh2DG467800 Rh3DG193900 Rh5AG437600 Rh5AG437700 Rh5AG437800 Rh5BG453700 Rh5DG468800 Rh7AG352500 Rh7CG369800 Rh7DG349000
rosa_wichuraiana Rw2G036410 Rw2G036460 Rw3G014910 Rw5G040940 Rw7G029760

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 12, 49
AfiI CCNNNNNNNGG 2 cut(s) 26, 160
AgsI TTSAA 1 cut(s) 113
AlwI GGATC 2 cut(s) 12, 49
Asp700I GAANNNNTTC 1 cut(s) 186
BccI CCATC 1 cut(s) 90
BfaI CTAG 1 cut(s) 26
BsaXI ACNNNNNCTCC 2 cut(s) 21, 51
Bsc4I CCNNNNNNNGG 2 cut(s) 26, 160
BseGI GGATG 1 cut(s) 101
BseLI CCNNNNNNNGG 2 cut(s) 26, 160
BseMII CTCAG 1 cut(s) 93
BslI CCNNNNNNNGG 2 cut(s) 26, 160
Bsp143I GATC 2 cut(s) 4, 41
BspCNI CTCAG 1 cut(s) 92
BspPI GGATC 2 cut(s) 12, 49
BssMI GATC 2 cut(s) 4, 41
BstC8I GCNNGC 1 cut(s) 85
BstDEI CTNAG 2 cut(s) 79, 119
BstF5I GGATG 1 cut(s) 101
BstKTI GATC 2 cut(s) 7, 44
BstMBI GATC 2 cut(s) 4, 41
BstNSI RCATGY 1 cut(s) 110
BtsCI GGATG 1 cut(s) 101
Cac8I GCNNGC 1 cut(s) 85
CviAII CATG 1 cut(s) 107
CviJI RGCY 2 cut(s) 87, 153
CviKI_1 RGCY 2 cut(s) 87, 153
DdeI CTNAG 2 cut(s) 79, 119
DpnI GATC 2 cut(s) 6, 43
DpnII GATC 2 cut(s) 4, 41
FaeI CATG 1 cut(s) 110
FaiI YATR 4 cut(s) 58, 108, 161, 200
FatI CATG 1 cut(s) 106
FokI GGATG 1 cut(s) 108
FspBI CTAG 1 cut(s) 26
Hin1II CATG 1 cut(s) 110
HinfI GANTC 1 cut(s) 11
Hpy166II GTNNAC 1 cut(s) 182
Hpy188III TCNNGA 1 cut(s) 8
Hpy8I GTNNAC 1 cut(s) 182
HpyAV CCTTC 2 cut(s) 94, 164
HpyF3I CTNAG 2 cut(s) 79, 119
Hsp92II CATG 1 cut(s) 110
Kzo9I GATC 2 cut(s) 4, 41
LmnI GCTCC 1 cut(s) 103
MaeI CTAG 1 cut(s) 26
MaeIII GTNAC 1 cut(s) 74
MalI GATC 2 cut(s) 6, 43
MboI GATC 2 cut(s) 4, 41
MluCI AATT 2 cut(s) 185, 194
MroXI GAANNNNTTC 1 cut(s) 186
NdeII GATC 2 cut(s) 4, 41
NlaIII CATG 1 cut(s) 110
NspI RCATGY 1 cut(s) 110
PdmI GAANNNNTTC 1 cut(s) 186
PfeI GAWTC 1 cut(s) 11
Sau3AI GATC 2 cut(s) 4, 41
SgeI CNNG 9 cut(s) 20, 33, 38, 57, 96, 119, 137, 158, 182
Sse9I AATT 2 cut(s) 185, 194
SspMI CTAG 1 cut(s) 26
TaqI TCGA 1 cut(s) 44
TasI AATT 2 cut(s) 185, 194
TfiI GAWTC 1 cut(s) 11
TspDTI ATGAA 1 cut(s) 187
XceI RCATGY 1 cut(s) 110
XmnI GAANNNNTTC 1 cut(s) 186
XspI CTAG 1 cut(s) 26
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.