Rh5DG468800

Domain of unknown function (DUF4220)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
OG0000618
Physical Location & Seq
Reverse (-)
74369894 .. 74390647
20754 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG468800.1

Sequence Viewer

Length: 192 bp
ATGTTCAAAAAGGCGTTCGTGCTCCTTTACGCAGATCTCACCATTGACTTTTGTAACACTGAAAACAGTTATCCTTTGATTGTGGGCAGTTCATCAGAAGATTACTTCGAAGTAGTAGAGATTGAGCTTGGTTTTATAGATGACCCAGAATTTTCTGACTCTTCACCAAACTTCACAAACACTGAAAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4220 DUF594

Protein Analysis

63

Amino Acids

7.17

Weight (kDa)

4.05

Isoelectric Point (pI)

44.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000618)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g04580 FvH4_3g37050 FvH4_3g37060 FvH4_4g30270 FvH4_6g34780 FvH4_6g34780
malus_domestica MD11G1092500.v1.1 MD17G1025500.v1.1
prunus_persica Prupe.1G206300_v2.0.a1 Prupe.3G040700_v2.0.a1 Prupe.3G040900_v2.0.a1 Prupe.3G041300_v2.0.a1 Prupe.3G041600_v2.0.a1 Prupe.3G061600_v2.0.a1 Prupe.4G109300_v2.0.a1 Prupe.6G069600_v2.0.a1 Prupe.6G069800_v2.0.a1 Prupe.6G069800_v2.0.a1 Prupe.6G069800_v2.0.a1 Prupe.8G014800_v2.0.a1 Prupe.8G037600_v2.0.a1
pyrus_communis pycom09g10050 pycom17g16040
rosa_chinensis RchiOBHm_Chr2g0145601 RchiOBHm_Chr5g0066461 RchiOBHm_Chr5g0066471 RchiOBHm_Chr5g0066481
rosa_laevigata RLG00000019691 RLG00000020148 RLG00000020153 RLG00000035869 RLG00000035878 RLG00000035880
rosa_multiflora Rmu_co8287763.1_g000001 Rmu_co8480723.1_g000001 Rmu_co8493537.1_g000001 Rmu_sc0002170.1_g000044 Rmu_sc0002599.1_g000001 Rmu_sc0002718.1_g000013 Rmu_sc0003046.1_g000008 Rmu_sc0007761.1_g000002
rosa_roxburghii Rroxscaffold_152G00434590 Rroxscaffold_1G00014400 Rroxscaffold_1G00014410 Rroxscaffold_1G00014570 Rroxscaffold_2G00100650 Rroxscaffold_2G00106640
rosa_rugosa Rorug02G0392200 Rorug02G0392400 Rorug05G0378500 Rorug05G0378500 Rorug05G0378500
rosa_samantha Rh2AG446400 Rh2AG446500 Rh2BG457100 Rh2BG457200 Rh2BG457300 Rh2BG458200 Rh2CG432200 Rh2CG433100 Rh2CG433200 Rh2DG466800 Rh2DG466900 Rh2DG467000 Rh2DG467800 Rh3DG193900 Rh5AG437600 Rh5AG437700 Rh5AG437800 Rh5BG453700 Rh5DG468800 Rh7AG352500 Rh7CG369800 Rh7DG349000
rosa_wichuraiana Rw2G036410 Rw2G036460 Rw3G014910 Rw5G040940 Rw7G029760

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 149
AgsI TTSAA 1 cut(s) 7
AluBI AGCT 1 cut(s) 127
AluI AGCT 1 cut(s) 127
Alw21I GWGCWC 1 cut(s) 24
ApoI RAATTY 1 cut(s) 149
AsuHPI GGTGA 2 cut(s) 31, 156
AsuII TTCGAA 1 cut(s) 108
Bbv12I GWGCWC 1 cut(s) 24
BglII AGATCT 1 cut(s) 34
Bpu14I TTCGAA 1 cut(s) 108
BsiHKAI GWGCWC 1 cut(s) 24
Bsp119I TTCGAA 1 cut(s) 108
Bsp1286I GDGCHC 1 cut(s) 24
Bsp143I GATC 1 cut(s) 34
BspT104I TTCGAA 1 cut(s) 108
BssMI GATC 1 cut(s) 34
Bst4CI ACNGT 1 cut(s) 68
Bst6I CTCTTC 1 cut(s) 166
BstBI TTCGAA 1 cut(s) 108
BstKTI GATC 1 cut(s) 37
BstMBI GATC 1 cut(s) 34
BstX2I RGATCY 1 cut(s) 34
BstYI RGATCY 1 cut(s) 34
BtsIMutI CAGTG 2 cut(s) 57, 180
CviJI RGCY 1 cut(s) 127
CviKI_1 RGCY 1 cut(s) 127
DpnI GATC 1 cut(s) 36
DpnII GATC 1 cut(s) 34
Eam1104I CTCTTC 1 cut(s) 166
EarI CTCTTC 1 cut(s) 166
FaiI YATR 1 cut(s) 137
FspEI CC 9 cut(s) 38, 55, 68, 69, 87, 114, 158, 159, 180
HinfI GANTC 1 cut(s) 158
HphI GGTGA 2 cut(s) 31, 156
Hpy188I TCNGA 2 cut(s) 97, 157
HpyCH4III ACNGT 1 cut(s) 68
Kzo9I GATC 1 cut(s) 34
LmnI GCTCC 1 cut(s) 27
LpnPI CCDG 1 cut(s) 159
MaeIII GTNAC 1 cut(s) 53
MalI GATC 1 cut(s) 36
MboI GATC 1 cut(s) 34
MboII GAAGA 2 cut(s) 110, 153
MflI RGATCY 1 cut(s) 34
MhlI GDGCHC 1 cut(s) 24
MluCI AATT 2 cut(s) 149, 187
MlyI GAGTC 1 cut(s) 152
MseI TTAA 1 cut(s) 190
NdeII GATC 1 cut(s) 34
NspV TTCGAA 1 cut(s) 108
PleI GAGTC 1 cut(s) 152
PpsI GAGTC 1 cut(s) 152
PsuI RGATCY 1 cut(s) 34
SaqAI TTAA 1 cut(s) 190
Sau3AI GATC 1 cut(s) 34
SchI GAGTC 1 cut(s) 152
SduI GDGCHC 1 cut(s) 24
SetI ASST 1 cut(s) 129
SfuI TTCGAA 1 cut(s) 108
SgeI CNNG 3 cut(s) 31, 140, 158
Sse9I AATT 2 cut(s) 149, 187
TaaI ACNGT 1 cut(s) 68
TaqI TCGA 1 cut(s) 108
TasI AATT 2 cut(s) 149, 187
Tru1I TTAA 1 cut(s) 190
Tru9I TTAA 1 cut(s) 190
TscAI CASTG 2 cut(s) 64, 187
TspDTI ATGAA 1 cut(s) 81
TspRI CASTG 2 cut(s) 64, 187
XapI RAATTY 1 cut(s) 149
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.