Prupe.4G198800_v2.0.a1

(-)-alpha-pinene synthase-like

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp04
Physical Location & Seq
Forward (+)
12196999 .. 12197537
539 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.4G198800.1

Sequence Viewer

Length: 252 bp
ATGAAGCAATATGGGGTGTCAGATGAGCAAGAGACAATTGATGTCTTCAACAAACAAATTGTGGATTCATGGAAAGATATGAACGAGGAGTTCCTAAGACCAACTTCTATGCCAATGCCTATCCTTGTACGTATTGTTAATTTAACAAGAGTCGTGGATCTCCTCTACAAAAAAGATGATGGCTACACACATGTTGGAAAAGTCATGAAAGATGGTGTTGCTTGTTATTTTATTGATCCGGCACCACTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

84

Amino Acids

9.6

Weight (kDa)

4.93

Isoelectric Point (pI)

43.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 241
AclWI GGATC 2 cut(s) 165, 230
AfaI GTAC 1 cut(s) 129
AflIII ACRYGT 1 cut(s) 190
AgsI TTSAA 1 cut(s) 49
Alw26I GTCTC 1 cut(s) 26
AlwI GGATC 2 cut(s) 165, 230
BanI GGYRCC 1 cut(s) 241
BbsI GAAGAC 1 cut(s) 37
BccI CCATC 2 cut(s) 173, 206
BcoDI GTCTC 1 cut(s) 26
BmiI GGNNCC 1 cut(s) 243
BpiI GAAGAC 1 cut(s) 37
BsaAI YACGTR 1 cut(s) 131
BseRI GAGGAG 2 cut(s) 101, 152
BshNI GGYRCC 1 cut(s) 241
BsiSI CCGG 1 cut(s) 239
BsmAI GTCTC 1 cut(s) 26
Bsp143I GATC 2 cut(s) 157, 235
BspHI TCATGA 1 cut(s) 204
BspLI GGNNCC 1 cut(s) 243
BspPI GGATC 2 cut(s) 165, 230
BspT107I GGYRCC 1 cut(s) 241
BssMI GATC 2 cut(s) 157, 235
BstBAI YACGTR 1 cut(s) 131
BstDEI CTNAG 1 cut(s) 95
BstKTI GATC 2 cut(s) 160, 238
BstMAI GTCTC 1 cut(s) 26
BstMBI GATC 2 cut(s) 157, 235
BstNSI RCATGY 1 cut(s) 194
BstSNI TACGTA 1 cut(s) 131
BstV2I GAAGAC 1 cut(s) 37
BstX2I RGATCY 1 cut(s) 157
BstYI RGATCY 1 cut(s) 157
CciI TCATGA 1 cut(s) 204
Csp6I GTAC 1 cut(s) 128
CspCI CAANNNNNGTGG 2 cut(s) 135, 170
CviAII CATG 3 cut(s) 69, 191, 205
CviJI RGCY 1 cut(s) 183
CviKI_1 RGCY 1 cut(s) 183
CviQI GTAC 1 cut(s) 128
DdeI CTNAG 1 cut(s) 95
DpnI GATC 2 cut(s) 159, 237
DpnII GATC 2 cut(s) 157, 235
Eco105I TACGTA 1 cut(s) 131
FaeI CATG 3 cut(s) 72, 194, 208
FaiI YATR 7 cut(s) 12, 70, 80, 110, 192, 206, 250
FalI AAGNNNNNCTT 2 cut(s) 88, 120
FatI CATG 3 cut(s) 68, 190, 204
HapII CCGG 1 cut(s) 239
Hin1II CATG 3 cut(s) 72, 194, 208
HinfI GANTC 2 cut(s) 65, 150
HpaII CCGG 1 cut(s) 239
Hpy188I TCNGA 1 cut(s) 22
Hpy188III TCNNGA 1 cut(s) 205
HpyCH4IV ACGT 1 cut(s) 130
HpyF3I CTNAG 1 cut(s) 95
HpySE526I ACGT 1 cut(s) 130
Hsp92II CATG 3 cut(s) 72, 194, 208
Kzo9I GATC 2 cut(s) 157, 235
MaeII ACGT 1 cut(s) 130
MalI GATC 2 cut(s) 159, 237
MboI GATC 2 cut(s) 157, 235
MboII GAAGA 1 cut(s) 37
MfeI CAATTG 1 cut(s) 36
MflI RGATCY 1 cut(s) 157
MluCI AATT 3 cut(s) 36, 57, 139
MlyI GAGTC 1 cut(s) 159
MmeI TCCRAC 1 cut(s) 175
MnlI CCTC 2 cut(s) 79, 173
MseI TTAA 2 cut(s) 138, 143
MspI CCGG 1 cut(s) 239
MunI CAATTG 1 cut(s) 36
NdeII GATC 2 cut(s) 157, 235
NlaIII CATG 3 cut(s) 72, 194, 208
NlaIV GGNNCC 1 cut(s) 243
NspI RCATGY 1 cut(s) 194
PagI TCATGA 1 cut(s) 204
PciI ACATGT 1 cut(s) 190
PfeI GAWTC 1 cut(s) 65
PleI GAGTC 1 cut(s) 158
PpsI GAGTC 1 cut(s) 158
Ppu21I YACGTR 1 cut(s) 131
PscI ACATGT 1 cut(s) 190
PspN4I GGNNCC 1 cut(s) 243
PsuI RGATCY 1 cut(s) 157
RsaI GTAC 1 cut(s) 129
RsaNI GTAC 1 cut(s) 128
SaqAI TTAA 2 cut(s) 138, 143
Sau3AI GATC 2 cut(s) 157, 235
SchI GAGTC 1 cut(s) 159
SetI ASST 1 cut(s) 133
SgeI CNNG 9 cut(s) 41, 81, 97, 137, 159, 166, 203, 217, 234
SnaBI TACGTA 1 cut(s) 131
Sse9I AATT 3 cut(s) 36, 57, 139
TaiI ACGT 1 cut(s) 133
TasI AATT 3 cut(s) 36, 57, 139
TfiI GAWTC 1 cut(s) 65
Tru1I TTAA 2 cut(s) 138, 143
Tru9I TTAA 2 cut(s) 138, 143
TspDTI ATGAA 4 cut(s) 17, 57, 95, 221
XceI RCATGY 1 cut(s) 194
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.