Rh3CG216700

(-)-alpha-pinene synthase-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
OG0000979
Physical Location & Seq
Forward (+)
20073269 .. 20074230
962 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG216700.1

Sequence Viewer

Length: 417 bp
ATGGATCAACTGCCAGACTATATGCAACCATTTTATCTAACACTTCTGGATGTTGTCAATGAAGTTGGGGAGGAACTGATAAAGCAAGGAAGATCATACCAACTTTACTATGTAAAAGAAATTTTTGAGAAAGAGAGAGGGCATGTTGCTTCTAGTATCGATTGCTACATGAATGAATATGGGGTCTCAGAGCAAGAGACAATTGATGTCTTTAACAAACAAATTGTGGATTCGTGGAAGGATATAAACGAAGAGTTTCTGAGACCCACTTCTGCGCCAATGCCTGTGCTTAATCGTATTCTTAACCTAACTGGAGTGGTTGATCTCCTTTACAAAAGGGGAGATGCCTTCACGCATGTTGGAAAACTGATGAAAGACGCTATTGCTTCACTGTTTATTGATCCAGTGCCACTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00909 map00909
Pfam Domains
Protein Families
Terpene_synth Terpene_synth_C

Protein Analysis

138

Amino Acids

15.93

Weight (kDa)

4.6

Isoelectric Point (pI)

49.76

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Terpene_synth_C PF03936 1 - 43 1.2e-06 Terpene synthase family, metal binding domain
Terpene_synth_C PF03936 42 - 81 2.2e-10 Terpene synthase family, metal binding domain
Terpene_syn_C_2 PF19086 42 - 81 8.1e-10 Terpene synthase family 2, C-terminal metal binding
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 12, 395
AcsI RAATTY 1 cut(s) 120
Alw26I GTCTC 3 cut(s) 190, 191, 256
AlwI GGATC 2 cut(s) 12, 395
ApoI RAATTY 1 cut(s) 120
Asp700I GAANNNNTTC 1 cut(s) 255
AspLEI GCGC 1 cut(s) 277
BcoDI GTCTC 3 cut(s) 190, 191, 256
BfaI CTAG 1 cut(s) 153
BmsI GCATC 1 cut(s) 334
BpmI CTGGAG 1 cut(s) 333
Bsa29I ATCGAT 1 cut(s) 159
BsaI GGTCTC 2 cut(s) 190, 256
Bse1I ACTGG 2 cut(s) 316, 404
BseCI ATCGAT 1 cut(s) 159
BseGI GGATG 1 cut(s) 55
BseMII CTCAG 2 cut(s) 201, 251
BseNI ACTGG 2 cut(s) 316, 404
BshVI ATCGAT 1 cut(s) 159
BsmAI GTCTC 3 cut(s) 190, 191, 256
Bso31I GGTCTC 2 cut(s) 190, 256
Bsp143I GATC 4 cut(s) 4, 92, 322, 400
BspCNI CTCAG 2 cut(s) 200, 252
BspDI ATCGAT 1 cut(s) 159
BspPI GGATC 2 cut(s) 12, 395
BspTNI GGTCTC 2 cut(s) 190, 256
BsrI ACTGG 2 cut(s) 316, 404
BssMI GATC 4 cut(s) 4, 92, 322, 400
Bst4CI ACNGT 1 cut(s) 393
Bst6I CTCTTC 1 cut(s) 246
BstDEI CTNAG 2 cut(s) 187, 260
BstF5I GGATG 1 cut(s) 55
BstHHI GCGC 1 cut(s) 277
BstKTI GATC 4 cut(s) 7, 95, 325, 403
BstMAI GTCTC 3 cut(s) 190, 191, 256
BstMBI GATC 4 cut(s) 4, 92, 322, 400
BstNSI RCATGY 2 cut(s) 146, 359
Bsu15I ATCGAT 1 cut(s) 159
BsuTUI ATCGAT 1 cut(s) 159
BtsCI GGATG 1 cut(s) 55
BtsIMutI CAGTG 2 cut(s) 389, 411
CfoI GCGC 1 cut(s) 277
ClaI ATCGAT 1 cut(s) 159
CseI GACGC 1 cut(s) 386
CviAII CATG 3 cut(s) 143, 169, 356
DdeI CTNAG 2 cut(s) 187, 260
DpnI GATC 4 cut(s) 6, 94, 324, 402
DpnII GATC 4 cut(s) 4, 92, 322, 400
Eam1104I CTCTTC 1 cut(s) 246
EarI CTCTTC 1 cut(s) 246
Eco31I GGTCTC 2 cut(s) 190, 256
FaeI CATG 3 cut(s) 146, 172, 359
FaiI YATR 9 cut(s) 21, 23, 97, 111, 144, 170, 180, 245, 357
FatI CATG 3 cut(s) 142, 168, 355
FokI GGATG 1 cut(s) 62
FspBI CTAG 1 cut(s) 153
GlaI GCGC 1 cut(s) 276
GsuI CTGGAG 1 cut(s) 333
HgaI GACGC 1 cut(s) 386
HhaI GCGC 1 cut(s) 277
Hin1II CATG 3 cut(s) 146, 172, 359
Hin6I GCGC 1 cut(s) 275
HinP1I GCGC 1 cut(s) 275
HinfI GANTC 1 cut(s) 230
Hpy188I TCNGA 3 cut(s) 190, 261, 416
Hpy188III TCNNGA 1 cut(s) 47
HpyAV CCTTC 2 cut(s) 232, 358
HpyCH4III ACNGT 1 cut(s) 393
HpyCH4V TGCA 1 cut(s) 25
HpyF3I CTNAG 2 cut(s) 187, 260
Hsp92II CATG 3 cut(s) 146, 172, 359
HspAI GCGC 1 cut(s) 275
Kzo9I GATC 4 cut(s) 4, 92, 322, 400
LpnPI CCDG 4 cut(s) 27, 32, 297, 297
LweI GCATC 1 cut(s) 334
MaeI CTAG 1 cut(s) 153
MalI GATC 4 cut(s) 6, 94, 324, 402
MboI GATC 4 cut(s) 4, 92, 322, 400
MboII GAAGA 2 cut(s) 102, 263
MfeI CAATTG 1 cut(s) 201
MluCI AATT 3 cut(s) 120, 201, 222
MmeI TCCRAC 1 cut(s) 340
MnlI CCTC 2 cut(s) 64, 131
MroXI GAANNNNTTC 1 cut(s) 255
MseI TTAA 3 cut(s) 213, 291, 303
MunI CAATTG 1 cut(s) 201
NdeII GATC 4 cut(s) 4, 92, 322, 400
NlaIII CATG 3 cut(s) 146, 172, 359
NspI RCATGY 2 cut(s) 146, 359
PdmI GAANNNNTTC 1 cut(s) 255
PfeI GAWTC 1 cut(s) 230
SaqAI TTAA 3 cut(s) 213, 291, 303
Sau3AI GATC 4 cut(s) 4, 92, 322, 400
SetI ASST 1 cut(s) 309
SfaNI GCATC 1 cut(s) 334
Sse9I AATT 3 cut(s) 120, 201, 222
SspMI CTAG 1 cut(s) 153
TaaI ACNGT 1 cut(s) 393
TaqI TCGA 1 cut(s) 159
TasI AATT 3 cut(s) 120, 201, 222
TfiI GAWTC 1 cut(s) 230
Tru1I TTAA 3 cut(s) 213, 291, 303
Tru9I TTAA 3 cut(s) 213, 291, 303
TscAI CASTG 2 cut(s) 396, 411
TspDTI ATGAA 4 cut(s) 75, 185, 189, 386
TspRI CASTG 2 cut(s) 396, 411
XapI RAATTY 1 cut(s) 120
XceI RCATGY 2 cut(s) 146, 359
XmnI GAANNNNTTC 1 cut(s) 255
XspI CTAG 1 cut(s) 153
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.