Rroxscaffold_2G00123050

(-)-germacrene D synthase-like

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Reverse (-)
56666152 .. 56679196
13045 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00123050.1

Sequence Viewer

Length: 243 bp
ATGAAAGAATTTAGTGCCACAGAAGAAGAAGCAATAATCCGATTGCGTAGACAAGTGAGTGATGCATGGAAGTACATAAATGAATCGTTCCTCCTCCCTAATGCTGTTTCAATGCCACTGCAAACTCGAATTCTCAATTATGCATGTGCTGCAGATGTTGTTTACAAGTATGGAGATGGTTACACTGTGGATATACTCAATGATCTTATAGCTCCTACACTATTCCAAAAAGTACCTATATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

80

Amino Acids

9.14

Weight (kDa)

4.89

Isoelectric Point (pI)

55.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 49
AcsI RAATTY 2 cut(s) 8, 129
AfaI GTAC 2 cut(s) 74, 234
AgsI TTSAA 1 cut(s) 111
AluBI AGCT 1 cut(s) 212
AluI AGCT 1 cut(s) 212
ApeKI GCWGC 1 cut(s) 149
ApoI RAATTY 2 cut(s) 8, 129
BbvI GCAGC 1 cut(s) 136
BccI CCATC 1 cut(s) 170
BfmI CTRYAG 1 cut(s) 150
BisI GCNGC 1 cut(s) 150
BlsI GCNGC 1 cut(s) 151
BmsI GCATC 1 cut(s) 52
BseRI GAGGAG 1 cut(s) 83
BseXI GCAGC 1 cut(s) 136
Bsp143I GATC 1 cut(s) 202
BspMAI CTGCAG 1 cut(s) 154
BssMI GATC 1 cut(s) 202
Bst4CI ACNGT 1 cut(s) 187
BstAPI GCANNNNNTGC 1 cut(s) 149
BstKTI GATC 1 cut(s) 205
BstMBI GATC 1 cut(s) 202
BstMWI GCNNNNNNNGC 1 cut(s) 149
BstNSI RCATGY 1 cut(s) 147
BstSFI CTRYAG 1 cut(s) 150
BstV1I GCAGC 1 cut(s) 136
BtsI GCAGTG 1 cut(s) 116
BtsIMutI CAGTG 2 cut(s) 116, 183
Csp6I GTAC 2 cut(s) 73, 233
CviAII CATG 2 cut(s) 66, 144
CviJI RGCY 1 cut(s) 212
CviKI_1 RGCY 1 cut(s) 212
CviQI GTAC 2 cut(s) 73, 233
DpnI GATC 1 cut(s) 204
DpnII GATC 1 cut(s) 202
EcoRI GAATTC 1 cut(s) 129
EcoT22I ATGCAT 2 cut(s) 67, 145
FaeI CATG 2 cut(s) 69, 147
FaiI YATR 9 cut(s) 67, 77, 141, 145, 171, 194, 209, 239, 241
FatI CATG 2 cut(s) 65, 143
FblI GTMKAC 1 cut(s) 49
Fnu4HI GCNGC 1 cut(s) 150
Fsp4HI GCNGC 1 cut(s) 150
GluI GCNGC 1 cut(s) 150
Hin1II CATG 2 cut(s) 69, 147
HinfI GANTC 1 cut(s) 83
Hpy166II GTNNAC 2 cut(s) 50, 163
Hpy188I TCNGA 1 cut(s) 41
Hpy8I GTNNAC 2 cut(s) 50, 163
HpyCH4III ACNGT 1 cut(s) 187
HpyCH4V TGCA 4 cut(s) 65, 121, 143, 152
HpyF10VI GCNNNNNNNGC 1 cut(s) 149
Hsp92II CATG 2 cut(s) 69, 147
Kzo9I GATC 1 cut(s) 202
LmnI GCTCC 1 cut(s) 217
Lsp1109I GCAGC 1 cut(s) 136
LweI GCATC 1 cut(s) 52
MaeIII GTNAC 1 cut(s) 179
MalI GATC 1 cut(s) 204
MboI GATC 1 cut(s) 202
MboII GAAGA 2 cut(s) 35, 38
MluCI AATT 3 cut(s) 8, 129, 136
MnlI CCTC 2 cut(s) 101, 104
Mph1103I ATGCAT 2 cut(s) 67, 145
MwoI GCNNNNNNNGC 1 cut(s) 149
NdeII GATC 1 cut(s) 202
NlaIII CATG 2 cut(s) 69, 147
NsiI ATGCAT 2 cut(s) 67, 145
NspI RCATGY 1 cut(s) 147
PfeI GAWTC 1 cut(s) 83
PkrI GCNGC 1 cut(s) 151
PstI CTGCAG 1 cut(s) 154
RsaI GTAC 2 cut(s) 74, 234
RsaNI GTAC 2 cut(s) 73, 233
SatI GCNGC 1 cut(s) 150
Sau3AI GATC 1 cut(s) 202
SetI ASST 2 cut(s) 214, 238
SfaNI GCATC 1 cut(s) 52
SfcI CTRYAG 1 cut(s) 150
SgeI CNNG 5 cut(s) 65, 78, 138, 156, 178
Sse9I AATT 3 cut(s) 8, 129, 136
TaaI ACNGT 1 cut(s) 187
TaqI TCGA 1 cut(s) 127
TasI AATT 3 cut(s) 8, 129, 136
TatI WGTACW 1 cut(s) 72
TfiI GAWTC 1 cut(s) 83
TscAI CASTG 2 cut(s) 123, 190
TseI GCWGC 1 cut(s) 149
TspDTI ATGAA 2 cut(s) 17, 96
TspRI CASTG 2 cut(s) 123, 190
XapI RAATTY 2 cut(s) 8, 129
XceI RCATGY 1 cut(s) 147
XmiI GTMKAC 1 cut(s) 49
Zsp2I ATGCAT 2 cut(s) 67, 145
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.