Rmu_sc0000149.1_g000030

(-)-alpha-pinene synthase-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000149.1
OG0000979
Physical Location & Seq
Forward (+)
110019 .. 110479
461 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000149.1_g000030.1.cds

Sequence Viewer

Length: 321 bp
atggatgacattggagggagcaagtgtgagaaacagaaaggggatgttgcttctagtattgattgctacatgaagcaatatggggtctcagaggaagacacaatcgatgtgttcaacaaacaatttgtggattcctggaaggaaataaatgaggatttacttcgaccagctgctttgccaatggttgtgctcatgcgcgttcttaatttcgcaagagatgtagatctggtttacaaaggagaagatggctatacacatgttgggaaagtagtaaaacatggtgtcgctgcactttttggtgatccattgccactcgaatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00909 map00909
Pfam Domains
Protein Families
Terpene_synth Terpene_synth_C

Protein Analysis

106

Amino Acids

11.81

Weight (kDa)

4.72

Isoelectric Point (pI)

31.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 198
AclWI GGATC 1 cut(s) 296
AflIII ACRYGT 1 cut(s) 256
AgsI TTSAA 1 cut(s) 115
AjnI CCWGG 1 cut(s) 134
AluBI AGCT 1 cut(s) 170
AluI AGCT 1 cut(s) 170
Alw21I GWGCWC 1 cut(s) 192
Alw26I GTCTC 1 cut(s) 91
AlwI GGATC 1 cut(s) 296
ApeKI GCWGC 2 cut(s) 170, 287
AspLEI GCGC 1 cut(s) 198
AsuHPI GGTGA 1 cut(s) 311
BbsI GAAGAC 1 cut(s) 102
Bbv12I GWGCWC 1 cut(s) 192
BbvI GCAGC 2 cut(s) 157, 274
BccI CCATC 1 cut(s) 239
BciT130I CCWGG 1 cut(s) 136
BcoDI GTCTC 1 cut(s) 91
BfaI CTAG 1 cut(s) 54
BglII AGATCT 1 cut(s) 223
BisI GCNGC 2 cut(s) 171, 288
BlsI GCNGC 2 cut(s) 172, 289
Bme1390I CCNGG 1 cut(s) 136
BmrFI CCNGG 1 cut(s) 136
BpiI GAAGAC 1 cut(s) 102
Bsa29I ATCGAT 1 cut(s) 105
BsaBI GATNNNNATC 1 cut(s) 222
BsaI GGTCTC 1 cut(s) 91
BsaXI ACNNNNNCTCC 2 cut(s) 10, 40
Bse3DI GCAATG 1 cut(s) 305
Bse8I GATNNNNATC 1 cut(s) 222
BseBI CCWGG 1 cut(s) 136
BseCI ATCGAT 1 cut(s) 105
BseGI GGATG 2 cut(s) 10, 49
BseJI GATNNNNATC 1 cut(s) 222
BseMI GCAATG 1 cut(s) 305
BseMII CTCAG 1 cut(s) 102
BseXI GCAGC 2 cut(s) 157, 274
BsgI GTGCAG 1 cut(s) 273
Bsh1236I CGCG 1 cut(s) 198
BshVI ATCGAT 1 cut(s) 105
BsiHKAI GWGCWC 1 cut(s) 192
BsmAI GTCTC 1 cut(s) 91
Bso31I GGTCTC 1 cut(s) 91
Bsp1286I GDGCHC 1 cut(s) 192
Bsp143I GATC 2 cut(s) 223, 301
BspCNI CTCAG 1 cut(s) 101
BspDI ATCGAT 1 cut(s) 105
BspFNI CGCG 1 cut(s) 198
BspPI GGATC 1 cut(s) 296
BspTNI GGTCTC 1 cut(s) 91
BsrDI GCAATG 1 cut(s) 305
BssMI GATC 2 cut(s) 223, 301
Bst2UI CCWGG 1 cut(s) 136
BstDEI CTNAG 1 cut(s) 88
BstF5I GGATG 2 cut(s) 10, 49
BstFNI CGCG 1 cut(s) 198
BstHHI GCGC 1 cut(s) 198
BstKTI GATC 2 cut(s) 226, 304
BstMAI GTCTC 1 cut(s) 91
BstMBI GATC 2 cut(s) 223, 301
BstNI CCWGG 1 cut(s) 136
BstNSI RCATGY 1 cut(s) 260
BstSCI CCNGG 1 cut(s) 134
BstUI CGCG 1 cut(s) 198
BstV1I GCAGC 2 cut(s) 157, 274
BstV2I GAAGAC 1 cut(s) 102
BstX2I RGATCY 1 cut(s) 223
BstYI RGATCY 1 cut(s) 223
Bsu15I ATCGAT 1 cut(s) 105
BsuTUI ATCGAT 1 cut(s) 105
BtsCI GGATG 2 cut(s) 10, 49
CfoI GCGC 1 cut(s) 198
ClaI ATCGAT 1 cut(s) 105
CviAII CATG 4 cut(s) 70, 193, 257, 278
CviJI RGCY 2 cut(s) 170, 249
CviKI_1 RGCY 2 cut(s) 170, 249
DdeI CTNAG 1 cut(s) 88
DpnI GATC 2 cut(s) 225, 303
DpnII GATC 2 cut(s) 223, 301
Eco31I GGTCTC 1 cut(s) 91
EcoRII CCWGG 1 cut(s) 134
FaeI CATG 4 cut(s) 73, 196, 260, 281
FaiI YATR 6 cut(s) 71, 81, 194, 252, 258, 279
FatI CATG 4 cut(s) 69, 192, 256, 277
Fnu4HI GCNGC 2 cut(s) 171, 288
FokI GGATG 2 cut(s) 17, 56
Fsp4HI GCNGC 2 cut(s) 171, 288
FspBI CTAG 1 cut(s) 54
GlaI GCGC 1 cut(s) 197
GluI GCNGC 2 cut(s) 171, 288
HhaI GCGC 1 cut(s) 198
Hin1II CATG 4 cut(s) 73, 196, 260, 281
Hin6I GCGC 1 cut(s) 196
HinP1I GCGC 1 cut(s) 196
HinfI GANTC 1 cut(s) 131
HphI GGTGA 1 cut(s) 311
Hpy166II GTNNAC 1 cut(s) 232
Hpy188I TCNGA 1 cut(s) 91
Hpy8I GTNNAC 1 cut(s) 232
HpyAV CCTTC 1 cut(s) 133
HpyCH4V TGCA 1 cut(s) 290
HpyF3I CTNAG 1 cut(s) 88
Hsp92II CATG 4 cut(s) 73, 196, 260, 281
HspAI GCGC 1 cut(s) 196
Kzo9I GATC 2 cut(s) 223, 301
LmnI GCTCC 1 cut(s) 18
LpnPI CCDG 4 cut(s) 121, 148, 180, 212
Lsp1109I GCAGC 2 cut(s) 157, 274
MaeI CTAG 1 cut(s) 54
MalI GATC 2 cut(s) 225, 303
MboI GATC 2 cut(s) 223, 301
MboII GAAGA 2 cut(s) 107, 254
MflI RGATCY 1 cut(s) 223
MhlI GDGCHC 1 cut(s) 192
MluCI AATT 2 cut(s) 122, 205
MnlI CCTC 3 cut(s) 8, 85, 145
MseI TTAA 1 cut(s) 204
MslI CAYNNNNRTG 1 cut(s) 316
MspA1I CMGCKG 1 cut(s) 170
MspR9I CCNGG 1 cut(s) 136
MvaI CCWGG 1 cut(s) 136
MvnI CGCG 1 cut(s) 198
NdeII GATC 2 cut(s) 223, 301
NlaIII CATG 4 cut(s) 73, 196, 260, 281
NspI RCATGY 1 cut(s) 260
PciI ACATGT 1 cut(s) 256
PfeI GAWTC 1 cut(s) 131
PfoI TCCNGGA 1 cut(s) 134
PkrI GCNGC 2 cut(s) 172, 289
PscI ACATGT 1 cut(s) 256
Psp6I CCWGG 1 cut(s) 134
PspGI CCWGG 1 cut(s) 134
PsuI RGATCY 1 cut(s) 223
PvuII CAGCTG 1 cut(s) 170
RseI CAYNNNNRTG 1 cut(s) 316
SaqAI TTAA 1 cut(s) 204
SatI GCNGC 2 cut(s) 171, 288
Sau3AI GATC 2 cut(s) 223, 301
ScrFI CCNGG 1 cut(s) 136
SduI GDGCHC 1 cut(s) 192
SetI ASST 1 cut(s) 172
SmiMI CAYNNNNRTG 1 cut(s) 316
Sse9I AATT 2 cut(s) 122, 205
SspMI CTAG 1 cut(s) 54
StyD4I CCNGG 1 cut(s) 134
TaqI TCGA 3 cut(s) 105, 163, 315
TasI AATT 2 cut(s) 122, 205
TfiI GAWTC 1 cut(s) 131
Tru1I TTAA 1 cut(s) 204
Tru9I TTAA 1 cut(s) 204
TseI GCWGC 2 cut(s) 170, 287
TspDTI ATGAA 1 cut(s) 86
XceI RCATGY 1 cut(s) 260
XspI CTAG 1 cut(s) 54
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.