Prupe.5G043400_v2.0.a1

oxidoreductase activity

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp05
OG0000805
Physical Location & Seq
Reverse (-)
4777432 .. 4778329
898 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.5G043400.1

Sequence Viewer

Length: 576 bp
ATGGCAGAGATAGATGAAGCTGTGACAAGAATGCTATTTGAAAGCTACGGTGTGAAGTACCATGACGATCACTTCCTATTGACTTTTCACGATCTCCGGCTTATAAAATACAAAGTACCCAAGAAACTTGGAGGTGACGTGCGTTTACGCAGTCATACAAACAAGACCTTTTCCACCATCCTCCATCAGAATCATGTCAGTGGCCTAGAGATCAATACAAAGAATGATGAGTGGGTAGCTTTTGATCCTCTACCTTCCTTAGTGGTATCCATAGCAGCTAGCCTTAGACACAAAGTCACATTTTGGAGCAACAATCGAATCCGACCCTGTAGACACAAAGTCACATTGAGGGAAAATGAGGTAAGATACTCTTTCGGAGCCCTTTTACTATACAAAGAGGTGATACGAGTACCAAATGAGCTGGTCGACAAGGACCACCCTTTACTCTACAAGCCTCTCAGTCATTTGGAATTTCTTAACGCACGTAAAATTGCGGGTGAAACTGAGTATGCCGGCAATAGGGGTGAACACAGTTCGGATTGGACCGGTTTTTGCTTCAAATTAGAACCGATCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
2OG-FeII_Oxy DIOX_N

Protein Analysis

192

Amino Acids

22.22

Weight (kDa)

8.8

Isoelectric Point (pI)

24.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 104
AccI GTMKAC 2 cut(s) 331, 426
AciI CCGC 1 cut(s) 494
AclWI GGATC 1 cut(s) 239
AcsI RAATTY 1 cut(s) 470
AfaI GTAC 3 cut(s) 59, 117, 411
AfiI CCNNNNNNNGG 1 cut(s) 519
AgeI ACCGGT 1 cut(s) 545
AgsI TTSAA 2 cut(s) 41, 559
AhdI GACNNNNNGTC 2 cut(s) 293, 338
AjiI CACGTC 1 cut(s) 139
AluBI AGCT 5 cut(s) 20, 45, 239, 278, 421
AluI AGCT 5 cut(s) 20, 45, 239, 278, 421
AlwI GGATC 1 cut(s) 239
AoxI GGCC 1 cut(s) 202
ApeKI GCWGC 1 cut(s) 275
ApoI RAATTY 1 cut(s) 470
AsiGI ACCGGT 1 cut(s) 545
AspS9I GGNCC 2 cut(s) 433, 543
AsuHPI GGTGA 4 cut(s) 146, 412, 509, 536
AsuNHI GCTAGC 1 cut(s) 278
AvaII GGWCC 2 cut(s) 433, 543
BanII GRGCYC 1 cut(s) 382
BbvI GCAGC 1 cut(s) 287
BccI CCATC 2 cut(s) 185, 192
BciVI GTATCC 1 cut(s) 277
BfaI CTAG 2 cut(s) 206, 279
BfmI CTRYAG 1 cut(s) 328
BfuI GTATCC 1 cut(s) 277
BisI GCNGC 1 cut(s) 276
BlsI GCNGC 1 cut(s) 277
Bme18I GGWCC 2 cut(s) 433, 543
BmeRI GACNNNNNGTC 2 cut(s) 293, 338
BmgBI CACGTC 1 cut(s) 139
BmgT120I GGNCC 2 cut(s) 433, 543
BmiI GGNNCC 1 cut(s) 379
BmtI GCTAGC 1 cut(s) 282
BsaAI YACGTR 1 cut(s) 485
BsaWI WCCGGW 1 cut(s) 545
BsaXI ACNNNNNCTCC 2 cut(s) 123, 153
Bsc4I CCNNNNNNNGG 1 cut(s) 519
Bse118I RCCGGY 2 cut(s) 512, 545
BseGI GGATG 1 cut(s) 177
BseLI CCNNNNNNNGG 1 cut(s) 519
BseMII CTCAG 2 cut(s) 472, 495
BseXI GCAGC 1 cut(s) 287
BshFI GGCC 1 cut(s) 204
BshTI ACCGGT 1 cut(s) 545
BsiSI CCGG 3 cut(s) 97, 513, 546
BslI CCNNNNNNNGG 1 cut(s) 519
BsmI GAATGC 1 cut(s) 36
BsnI GGCC 1 cut(s) 204
Bsp1286I GDGCHC 1 cut(s) 382
Bsp143I GATC 5 cut(s) 67, 91, 210, 244, 570
BspACI CCGC 1 cut(s) 494
BspANI GGCC 1 cut(s) 204
BspCNI CTCAG 2 cut(s) 471, 496
BspLI GGNNCC 1 cut(s) 379
BspOI GCTAGC 1 cut(s) 282
BspPI GGATC 1 cut(s) 239
BsrFI RCCGGY 2 cut(s) 512, 545
BssAI RCCGGY 2 cut(s) 512, 545
BssMI GATC 5 cut(s) 67, 91, 210, 244, 570
Bst4CI ACNGT 2 cut(s) 50, 533
BstBAI YACGTR 1 cut(s) 485
BstC8I GCNNGC 2 cut(s) 280, 514
BstDEI CTNAG 4 cut(s) 259, 284, 458, 504
BstF5I GGATG 1 cut(s) 177
BstKTI GATC 5 cut(s) 70, 94, 213, 247, 573
BstMBI GATC 5 cut(s) 67, 91, 210, 244, 570
BstSFI CTRYAG 1 cut(s) 328
BstV1I GCAGC 1 cut(s) 287
BsuI GTATCC 1 cut(s) 277
BsuRI GGCC 1 cut(s) 204
BtrI CACGTC 1 cut(s) 139
BtsCI GGATG 1 cut(s) 177
BtsIMutI CAGTG 1 cut(s) 205
Cac8I GCNNGC 2 cut(s) 280, 514
Cfr10I RCCGGY 2 cut(s) 512, 545
Cfr13I GGNCC 2 cut(s) 433, 543
Csp6I GTAC 3 cut(s) 58, 116, 410
CspAI ACCGGT 1 cut(s) 545
CviAII CATG 2 cut(s) 62, 194
CviQI GTAC 3 cut(s) 58, 116, 410
DdeI CTNAG 4 cut(s) 259, 284, 458, 504
DpnI GATC 5 cut(s) 69, 93, 212, 246, 572
DpnII GATC 5 cut(s) 67, 91, 210, 244, 570
DriI GACNNNNNGTC 2 cut(s) 293, 338
Eam1105I GACNNNNNGTC 2 cut(s) 293, 338
Eco24I GRGCYC 1 cut(s) 382
Eco47I GGWCC 2 cut(s) 433, 543
EcoT38I GRGCYC 1 cut(s) 382
FaeI CATG 2 cut(s) 65, 197
FaiI YATR 7 cut(s) 63, 104, 156, 195, 272, 391, 510
FalI AAGNNNNNCTT 2 cut(s) 355, 387
FatI CATG 2 cut(s) 61, 193
FauI CCCGC 1 cut(s) 487
FblI GTMKAC 2 cut(s) 331, 426
Fnu4HI GCNGC 1 cut(s) 276
FokI GGATG 1 cut(s) 164
FriOI GRGCYC 1 cut(s) 382
Fsp4HI GCNGC 1 cut(s) 276
FspBI CTAG 2 cut(s) 206, 279
GluI GCNGC 1 cut(s) 276
HaeIII GGCC 1 cut(s) 204
HapII CCGG 3 cut(s) 97, 513, 546
Hin1II CATG 2 cut(s) 65, 197
HincII GTYRAC 1 cut(s) 427
HindII GTYRAC 1 cut(s) 427
HinfI GANTC 2 cut(s) 190, 318
HpaII CCGG 3 cut(s) 97, 513, 546
HphI GGTGA 4 cut(s) 146, 412, 509, 536
Hpy166II GTNNAC 4 cut(s) 146, 332, 427, 527
Hpy188I TCNGA 5 cut(s) 189, 323, 377, 538, 575
Hpy188III TCNNGA 1 cut(s) 89
Hpy8I GTNNAC 4 cut(s) 146, 332, 427, 527
HpyAV CCTTC 1 cut(s) 264
HpyCH4III ACNGT 2 cut(s) 50, 533
HpyCH4IV ACGT 2 cut(s) 138, 484
HpyF3I CTNAG 4 cut(s) 259, 284, 458, 504
HpySE526I ACGT 2 cut(s) 138, 484
Hsp92II CATG 2 cut(s) 65, 197
KroI GCCGGC 1 cut(s) 512
KroNI GCCGGC 1 cut(s) 514
Kzo9I GATC 5 cut(s) 67, 91, 210, 244, 570
LmnI GCTCC 2 cut(s) 306, 377
LpnPI CCDG 5 cut(s) 110, 340, 407, 526, 559
Lsp1109I GCAGC 1 cut(s) 287
MaeI CTAG 2 cut(s) 206, 279
MaeII ACGT 2 cut(s) 138, 484
MaeIII GTNAC 4 cut(s) 22, 134, 295, 340
MalI GATC 5 cut(s) 69, 93, 212, 246, 572
MboI GATC 5 cut(s) 67, 91, 210, 244, 570
MhlI GDGCHC 1 cut(s) 382
MluCI AATT 3 cut(s) 470, 489, 560
MmeI TCCRAC 1 cut(s) 346
MnlI CCTC 7 cut(s) 125, 191, 258, 342, 352, 391, 465
MroNI GCCGGC 1 cut(s) 512
MseI TTAA 1 cut(s) 477
MslI CAYNNNNRTG 1 cut(s) 198
MspI CCGG 3 cut(s) 97, 513, 546
Mva1269I GAATGC 1 cut(s) 36
NaeI GCCGGC 1 cut(s) 514
NdeII GATC 5 cut(s) 67, 91, 210, 244, 570
NgoMIV GCCGGC 1 cut(s) 512
NheI GCTAGC 1 cut(s) 278
NlaIII CATG 2 cut(s) 65, 197
NlaIV GGNNCC 1 cut(s) 379
NmuCI GTSAC 4 cut(s) 22, 134, 295, 340
PctI GAATGC 1 cut(s) 36
PdiI GCCGGC 1 cut(s) 514
PfeI GAWTC 2 cut(s) 190, 318
PinAI ACCGGT 1 cut(s) 545
PkrI GCNGC 1 cut(s) 277
Ppu21I YACGTR 1 cut(s) 485
PsiI TTATAA 1 cut(s) 104
PspN4I GGNNCC 1 cut(s) 379
PspPI GGNCC 2 cut(s) 433, 543
RsaI GTAC 3 cut(s) 59, 117, 411
RsaNI GTAC 3 cut(s) 58, 116, 410
RseI CAYNNNNRTG 1 cut(s) 198
SalI GTCGAC 1 cut(s) 425
SaqAI TTAA 1 cut(s) 477
SatI GCNGC 1 cut(s) 276
Sau3AI GATC 5 cut(s) 67, 91, 210, 244, 570
Sau96I GGNCC 2 cut(s) 433, 543
SduI GDGCHC 1 cut(s) 382
SfcI CTRYAG 1 cut(s) 328
SinI GGWCC 2 cut(s) 433, 543
SmiMI CAYNNNNRTG 1 cut(s) 198
Sse9I AATT 3 cut(s) 470, 489, 560
SsiI CCGC 1 cut(s) 494
SspMI CTAG 2 cut(s) 206, 279
TaaI ACNGT 2 cut(s) 50, 533
TaiI ACGT 2 cut(s) 141, 487
TaqI TCGA 2 cut(s) 316, 426
TasI AATT 3 cut(s) 470, 489, 560
TfiI GAWTC 2 cut(s) 190, 318
Tru1I TTAA 1 cut(s) 477
Tru9I TTAA 1 cut(s) 477
TscAI CASTG 1 cut(s) 205
TseFI GTSAC 4 cut(s) 22, 134, 295, 340
TseI GCWGC 1 cut(s) 275
Tsp45I GTSAC 4 cut(s) 22, 134, 295, 340
TspDTI ATGAA 1 cut(s) 30
TspRI CASTG 1 cut(s) 205
VpaK11BI GGWCC 2 cut(s) 433, 543
XapI RAATTY 1 cut(s) 470
XmiI GTMKAC 2 cut(s) 331, 426
XspI CTAG 2 cut(s) 206, 279
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.