Rmu_sc0000841.1_g000009

oxidoreductase activity

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000841.1
OG0000805
Physical Location & Seq
Forward (+)
29946 .. 31113
1168 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000841.1_g000009.1.cds

Sequence Viewer

Length: 951 bp
atggcaatgagcatgaatccccaaacagtggccaaaataccagtggtagatttctccaaagaggactgcttgaagccagggacaagctcttggctctcggcaagcaaaggtgtttgccaagcactcgaacagctcggctgtttcattgtaacactttctagtaacaaagtttctttggagcttcacaacacaatcttcagaacgttgaacgagttgtttgatctcccgatggaaatcaaagtgccaaatactaacaaaaacgacggcgctggtggctactcgactttgcatcctgcccatgaaagctttgggattgttaatagtacgaacccggaagaaacacagaagttcacaaatcgcttttggactaatggaaacgatcagtttcgtgagagtgttgattcgtatgcaaaagtgatggcagaactagatcgagctgtgacaagaatggtattcgaaaactatggtgtagacaagtaccacgatgatcacgttcaatctacttttcacggtctccgatttagtaaatacaaagaacccaagaaaactggaattgacgtcggtctaggcagtcatacagataagacctttaccaccatcctccatcaaaataatgtgaatggtctagagataaatacgaagaacgaccagtggatacgctgtgattatcctcttccttcatccttcctattcctagcaggcgatgtattccaggtctggagcaatgacagaatacgaccttgtagacatagagtcagcttgactgagaatcatgtgagatactctttcggactctattcgatcaaggaaggagtgacaaacataccggacgagcttgtggacgaggaccatcccctacggtttaagccattgaatcatatagcatatgctagagcaagatatgacagcaatgggactgacttgggcgtcaagtcatattgtggcatttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
2OG-FeII_Oxy DIOX_N

Protein Analysis

316

Amino Acids

35.8

Weight (kDa)

6.31

Isoelectric Point (pI)

22.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 926
AatII GACGTC 1 cut(s) 561
AccB7I CCANNNNNTGG 1 cut(s) 28
AccI GTMKAC 2 cut(s) 471, 745
AclI AACGTT 1 cut(s) 203
AcoI YGGCCR 1 cut(s) 30
AcuI CTGAAG 1 cut(s) 181
AcyI GRCGYC 2 cut(s) 558, 927
AfaI GTAC 2 cut(s) 325, 479
AfiI CCNNNNNNNGG 1 cut(s) 28
AgsI TTSAA 4 cut(s) 73, 208, 497, 874
AhdI GACNNNNNGTC 1 cut(s) 752
AjnI CCWGG 2 cut(s) 76, 711
AluBI AGCT 7 cut(s) 87, 133, 181, 306, 437, 759, 835
AluI AGCT 7 cut(s) 87, 133, 181, 306, 437, 759, 835
Alw26I GTCTC 1 cut(s) 518
AoxI GGCC 1 cut(s) 30
AspLEI GCGC 1 cut(s) 269
AspS9I GGNCC 1 cut(s) 847
AsuC2I CCSGG 1 cut(s) 332
AsuII TTCGAA 1 cut(s) 456
AvaII GGWCC 1 cut(s) 847
BalI TGGCCA 1 cut(s) 32
BccI CCATC 5 cut(s) 223, 412, 605, 612, 858
BceAI ACGGC 1 cut(s) 280
BciT130I CCWGG 2 cut(s) 78, 713
BciVI GTATCC 1 cut(s) 648
BclI TGATCA 1 cut(s) 487
BcnI CCSGG 1 cut(s) 332
BcoDI GTCTC 1 cut(s) 518
BfaI CTAG 6 cut(s) 159, 428, 566, 626, 695, 891
BfoI RGCGCY 1 cut(s) 270
BfuI GTATCC 1 cut(s) 648
Bme1390I CCNGG 3 cut(s) 78, 332, 713
Bme18I GGWCC 1 cut(s) 847
BmeRI GACNNNNNGTC 1 cut(s) 752
BmgT120I GGNCC 1 cut(s) 847
BmrFI CCNGG 3 cut(s) 78, 332, 713
BmsI GCATC 1 cut(s) 298
BoxI GACNNNNGTC 1 cut(s) 561
BpmI CTGGAG 1 cut(s) 739
Bpu14I TTCGAA 1 cut(s) 456
BpuMI CCSGG 1 cut(s) 332
BsaBI GATNNNNATC 1 cut(s) 233
BsaHI GRCGYC 2 cut(s) 558, 927
BsaI GGTCTC 1 cut(s) 518
BsaJI CCNNGG 1 cut(s) 77
BsaWI WCCGGW 1 cut(s) 826
Bsc4I CCNNNNNNNGG 1 cut(s) 28
Bse1I ACTGG 3 cut(s) 41, 553, 649
Bse3DI GCAATG 3 cut(s) 12, 730, 916
Bse8I GATNNNNATC 1 cut(s) 233
BseBI CCWGG 2 cut(s) 78, 713
BseDI CCNNGG 1 cut(s) 77
BseGI GGATG 4 cut(s) 289, 597, 680, 850
BseJI GATNNNNATC 1 cut(s) 233
BseLI CCNNNNNNNGG 1 cut(s) 28
BseMI GCAATG 3 cut(s) 12, 730, 916
BseMII CTCAG 1 cut(s) 756
BseNI ACTGG 3 cut(s) 41, 553, 649
BshFI GGCC 1 cut(s) 32
BsiSI CCGG 2 cut(s) 332, 827
BslFI GGGAC 2 cut(s) 94, 928
BslI CCNNNNNNNGG 1 cut(s) 28
BsmAI GTCTC 1 cut(s) 518
BsmFI GGGAC 2 cut(s) 94, 928
BsnI GGCC 1 cut(s) 32
Bso31I GGTCTC 1 cut(s) 518
Bsp119I TTCGAA 1 cut(s) 456
Bsp143I GATC 5 cut(s) 220, 379, 430, 487, 801
BspANI GGCC 1 cut(s) 32
BspCNI CTCAG 1 cut(s) 757
BspT104I TTCGAA 1 cut(s) 456
BspTNI GGTCTC 1 cut(s) 518
BsrDI GCAATG 3 cut(s) 12, 730, 916
BsrI ACTGG 3 cut(s) 41, 553, 649
BssECI CCNNGG 1 cut(s) 77
BssMI GATC 5 cut(s) 220, 379, 430, 487, 801
BssNI GRCGYC 2 cut(s) 558, 927
Bst2UI CCWGG 2 cut(s) 78, 713
Bst4CI ACNGT 3 cut(s) 28, 512, 861
Bst6I CTCTTC 1 cut(s) 678
BstACI GRCGYC 2 cut(s) 558, 927
BstBI TTCGAA 1 cut(s) 456
BstC8I GCNNGC 2 cut(s) 103, 700
BstDEI CTNAG 1 cut(s) 765
BstF5I GGATG 4 cut(s) 289, 597, 680, 850
BstH2I RGCGCY 1 cut(s) 270
BstHHI GCGC 1 cut(s) 269
BstKTI GATC 5 cut(s) 223, 382, 433, 490, 804
BstMAI GTCTC 1 cut(s) 518
BstMBI GATC 5 cut(s) 220, 379, 430, 487, 801
BstMWI GCNNNNNNNGC 1 cut(s) 273
BstNI CCWGG 2 cut(s) 78, 713
BstPAI GACNNNNGTC 1 cut(s) 561
BstSCI CCNGG 3 cut(s) 76, 330, 711
BsuI GTATCC 1 cut(s) 648
BsuRI GGCC 1 cut(s) 32
BtgZI GCGATG 1 cut(s) 717
BtsCI GGATG 4 cut(s) 289, 597, 680, 850
BtsIMutI CAGTG 3 cut(s) 33, 48, 656
Cac8I GCNNGC 2 cut(s) 103, 700
CfoI GCGC 1 cut(s) 269
Cfr13I GGNCC 1 cut(s) 847
CseI GACGC 1 cut(s) 916
Csp6I GTAC 2 cut(s) 324, 478
CviAII CATG 3 cut(s) 13, 299, 773
CviQI GTAC 2 cut(s) 324, 478
DdeI CTNAG 1 cut(s) 765
DpnI GATC 5 cut(s) 222, 381, 432, 489, 803
DpnII GATC 5 cut(s) 220, 379, 430, 487, 801
DrdI GACNNNNNNGTC 1 cut(s) 926
DriI GACNNNNNGTC 1 cut(s) 752
DseDI GACNNNNNNGTC 1 cut(s) 926
EaeI YGGCCR 1 cut(s) 30
Eam1104I CTCTTC 1 cut(s) 678
Eam1105I GACNNNNNGTC 1 cut(s) 752
EarI CTCTTC 1 cut(s) 678
Eco31I GGTCTC 1 cut(s) 518
Eco47I GGWCC 1 cut(s) 847
Eco57I CTGAAG 1 cut(s) 181
EcoRII CCWGG 2 cut(s) 76, 711
FaeI CATG 3 cut(s) 16, 302, 776
FaqI GGGAC 2 cut(s) 94, 928
FatI CATG 3 cut(s) 12, 298, 772
FauNDI CATATG 1 cut(s) 886
FbaI TGATCA 1 cut(s) 487
FblI GTMKAC 2 cut(s) 471, 745
FokI GGATG 4 cut(s) 276, 584, 667, 837
FspBI CTAG 6 cut(s) 159, 428, 566, 626, 695, 891
GlaI GCGC 1 cut(s) 268
GsuI CTGGAG 1 cut(s) 739
HaeII RGCGCY 1 cut(s) 270
HaeIII GGCC 1 cut(s) 32
HapII CCGG 2 cut(s) 332, 827
HgaI GACGC 1 cut(s) 916
HhaI GCGC 1 cut(s) 269
Hin1I GRCGYC 2 cut(s) 558, 927
Hin1II CATG 3 cut(s) 16, 302, 776
Hin6I GCGC 1 cut(s) 267
HinP1I GCGC 1 cut(s) 267
HindIII AAGCTT 1 cut(s) 304
HinfI GANTC 6 cut(s) 16, 401, 753, 769, 792, 874
HpaII CCGG 2 cut(s) 332, 827
Hpy166II GTNNAC 4 cut(s) 351, 472, 746, 841
Hpy188I TCNGA 3 cut(s) 200, 518, 791
Hpy188III TCNNGA 4 cut(s) 226, 389, 626, 718
Hpy8I GTNNAC 4 cut(s) 351, 472, 746, 841
Hpy99I CGWCG 2 cut(s) 266, 563
HpyAV CCTTC 3 cut(s) 687, 694, 803
HpyCH4III ACNGT 3 cut(s) 28, 512, 861
HpyCH4IV ACGT 3 cut(s) 203, 492, 558
HpyCH4V TGCA 2 cut(s) 289, 410
HpyF10VI GCNNNNNNNGC 1 cut(s) 273
HpyF3I CTNAG 1 cut(s) 765
HpySE526I ACGT 3 cut(s) 203, 492, 558
Hsp92I GRCGYC 2 cut(s) 558, 927
Hsp92II CATG 3 cut(s) 16, 302, 776
HspAI GCGC 1 cut(s) 267
Ksp22I TGATCA 1 cut(s) 487
Kzo9I GATC 5 cut(s) 220, 379, 430, 487, 801
LmnI GCTCC 2 cut(s) 178, 720
LweI GCATC 1 cut(s) 298
MaeI CTAG 6 cut(s) 159, 428, 566, 626, 695, 891
MaeII ACGT 3 cut(s) 203, 492, 558
MaeIII GTNAC 4 cut(s) 148, 161, 439, 814
MalI GATC 5 cut(s) 222, 381, 432, 489, 803
MboI GATC 5 cut(s) 220, 379, 430, 487, 801
MboII GAAGA 4 cut(s) 187, 347, 652, 665
MlsI TGGCCA 1 cut(s) 32
MluCI AATT 1 cut(s) 552
MluNI TGGCCA 1 cut(s) 32
MlyI GAGTC 2 cut(s) 762, 786
MnlI CCTC 4 cut(s) 55, 611, 681, 838
Mox20I TGGCCA 1 cut(s) 32
MscI TGGCCA 1 cut(s) 32
MseI TTAA 2 cut(s) 318, 864
Msp20I TGGCCA 1 cut(s) 32
MspI CCGG 2 cut(s) 332, 827
MspR9I CCNGG 3 cut(s) 78, 332, 713
MvaI CCWGG 2 cut(s) 78, 713
MwoI GCNNNNNNNGC 1 cut(s) 273
NciI CCSGG 1 cut(s) 332
NdeI CATATG 1 cut(s) 886
NdeII GATC 5 cut(s) 220, 379, 430, 487, 801
NlaIII CATG 3 cut(s) 16, 302, 776
NmeAIII GCCGAG 2 cut(s) 77, 114
NmuCI GTSAC 2 cut(s) 439, 814
NspV TTCGAA 1 cut(s) 456
PcsI WCGNNNNNNNCGW 1 cut(s) 489
PfeI GAWTC 4 cut(s) 16, 401, 769, 874
PflMI CCANNNNNTGG 1 cut(s) 28
PleI GAGTC 2 cut(s) 761, 786
PpsI GAGTC 2 cut(s) 761, 786
PshAI GACNNNNGTC 1 cut(s) 561
Psp1406I AACGTT 1 cut(s) 203
Psp6I CCWGG 2 cut(s) 76, 711
PspGI CCWGG 2 cut(s) 76, 711
PspPI GGNCC 1 cut(s) 847
RsaI GTAC 2 cut(s) 325, 479
RsaNI GTAC 2 cut(s) 324, 478
SaqAI TTAA 2 cut(s) 318, 864
Sau3AI GATC 5 cut(s) 220, 379, 430, 487, 801
Sau96I GGNCC 1 cut(s) 847
SchI GAGTC 2 cut(s) 762, 786
ScrFI CCNGG 3 cut(s) 78, 332, 713
SfaNI GCATC 1 cut(s) 298
SfuI TTCGAA 1 cut(s) 456
SinI GGWCC 1 cut(s) 847
Sse9I AATT 1 cut(s) 552
SspMI CTAG 6 cut(s) 159, 428, 566, 626, 695, 891
StyD4I CCNGG 3 cut(s) 76, 330, 711
TaaI ACNGT 3 cut(s) 28, 512, 861
TaiI ACGT 3 cut(s) 206, 495, 561
TaqI TCGA 5 cut(s) 126, 281, 433, 456, 800
TaqII GACCGA 1 cut(s) 551
TasI AATT 1 cut(s) 552
TfiI GAWTC 4 cut(s) 16, 401, 769, 874
Tru1I TTAA 2 cut(s) 318, 864
Tru9I TTAA 2 cut(s) 318, 864
TscAI CASTG 3 cut(s) 33, 48, 656
TseFI GTSAC 2 cut(s) 439, 814
Tsp45I GTSAC 2 cut(s) 439, 814
TspDTI ATGAA 4 cut(s) 29, 133, 315, 669
TspRI CASTG 3 cut(s) 33, 48, 656
Van91I CCANNNNNTGG 1 cut(s) 28
VpaK11BI GGWCC 1 cut(s) 847
XbaI TCTAGA 1 cut(s) 625
XcmI CCANNNNNNNNNTGG 2 cut(s) 40, 305
XmiI GTMKAC 2 cut(s) 471, 745
XspI CTAG 6 cut(s) 159, 428, 566, 626, 695, 891
ZraI GACGTC 1 cut(s) 559
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.