RchiOBHm_Chr2g0152401

Ribonuclease H protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
69807352 .. 69807932
581 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 498 bp
ATGCATTACTTTAAATTAAATGTTGATGGTGCTAGAAGTATTAATGGGAAAATTGGTGTTGGCGGTGTCTTAAGGGATTCTACGGGTGCTTGGGTTTCTGGGTTTTATGCTAATCTTGGATGCGGATCTGTCCTTCAGGCGGAAGCTTGGGGGTTACTTCTGGGTCTACAAATGGCCATCTCTCATCATGCCCATCATCTTCTGGTGGAAAGTGATTCTCAGGTGTTAGTCTCCCTCGTCCAGCATGATGTGGATGATTTGCACCCCTTAAAAACCATTACTGATTGTTGCCAAACCCTCCAAAGACAATTGCATAGCTGCGATCTTAAGCATGTCTACCGCGAAGTTAATCAGGTTGCTGACATTCTCTCCAAATTTGGTTTGGATGCAGAGATTGGAGTTCATTTCATGGAGCAACCCCCTCCACAAGTTAATTCTAGCTTGCTTGATGACCTGTGTGGCAGTCCTAGAATTAGGACTATAAATTCTGAGCTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

165

Amino Acids

18.09

Weight (kDa)

5.71

Isoelectric Point (pI)

37.41

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RVT_3 PF13456 7 - 126 1.6e-26 Reverse transcriptase-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000890)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 2 cut(s) 166, 336
AccII CGCG 1 cut(s) 342
AciI CCGC 4 cut(s) 63, 123, 140, 340
AclWI GGATC 1 cut(s) 133
AcoI YGGCCR 1 cut(s) 174
AcsI RAATTY 2 cut(s) 374, 484
AcuI CTGAAG 1 cut(s) 119
AfiI CCNNNNNNNGG 1 cut(s) 139
AflII CTTAAG 2 cut(s) 70, 326
AluBI AGCT 4 cut(s) 146, 318, 441, 493
AluI AGCT 4 cut(s) 146, 318, 441, 493
Alw26I GTCTC 1 cut(s) 235
AlwI GGATC 1 cut(s) 133
AoxI GGCC 1 cut(s) 174
ApeKI GCWGC 1 cut(s) 318
ApoI RAATTY 2 cut(s) 374, 484
AseI ATTAAT 1 cut(s) 42
BalI TGGCCA 1 cut(s) 176
BbvI GCAGC 1 cut(s) 305
BccI CCATC 3 cut(s) 20, 185, 201
BcoDI GTCTC 1 cut(s) 235
BfaI CTAG 3 cut(s) 33, 438, 468
BfrI CTTAAG 2 cut(s) 70, 326
BisI GCNGC 1 cut(s) 319
BlsI GCNGC 1 cut(s) 320
BmsI GCATC 2 cut(s) 110, 376
BsaBI GATNNNNATC 1 cut(s) 124
BsaXI ACNNNNNCTCC 2 cut(s) 353, 383
Bsc4I CCNNNNNNNGG 1 cut(s) 139
Bse8I GATNNNNATC 1 cut(s) 124
BseGI GGATG 3 cut(s) 125, 259, 391
BseJI GATNNNNATC 1 cut(s) 124
BseLI CCNNNNNNNGG 1 cut(s) 139
BseMII CTCAG 2 cut(s) 233, 480
BseXI GCAGC 1 cut(s) 305
Bsh1236I CGCG 1 cut(s) 342
BshFI GGCC 1 cut(s) 176
BslI CCNNNNNNNGG 1 cut(s) 139
BsmAI GTCTC 1 cut(s) 235
BsnI GGCC 1 cut(s) 176
Bsp143I GATC 2 cut(s) 125, 322
BspACI CCGC 4 cut(s) 63, 123, 140, 340
BspANI GGCC 1 cut(s) 176
BspCNI CTCAG 2 cut(s) 232, 481
BspFNI CGCG 1 cut(s) 342
BspPI GGATC 1 cut(s) 133
BspTI CTTAAG 2 cut(s) 70, 326
BssMI GATC 2 cut(s) 125, 322
BstAFI CTTAAG 2 cut(s) 70, 326
BstC8I GCNNGC 1 cut(s) 443
BstDEI CTNAG 2 cut(s) 219, 489
BstF5I GGATG 3 cut(s) 125, 259, 391
BstFNI CGCG 1 cut(s) 342
BstKTI GATC 2 cut(s) 128, 325
BstMAI GTCTC 1 cut(s) 235
BstMBI GATC 2 cut(s) 125, 322
BstNSI RCATGY 1 cut(s) 335
BstUI CGCG 1 cut(s) 342
BstV1I GCAGC 1 cut(s) 305
BstX2I RGATCY 1 cut(s) 125
BstYI RGATCY 1 cut(s) 125
BsuRI GGCC 1 cut(s) 176
BtsCI GGATG 3 cut(s) 125, 259, 391
Cac8I GCNNGC 1 cut(s) 443
CviAII CATG 4 cut(s) 188, 245, 332, 409
CviJI RGCY 5 cut(s) 146, 176, 318, 441, 493
CviKI_1 RGCY 5 cut(s) 146, 176, 318, 441, 493
DdeI CTNAG 2 cut(s) 219, 489
DpnI GATC 2 cut(s) 127, 324
DpnII GATC 2 cut(s) 125, 322
DraI TTTAAA 1 cut(s) 13
EaeI YGGCCR 1 cut(s) 174
EciI GGCGGA 1 cut(s) 155
Eco57I CTGAAG 1 cut(s) 119
EcoT22I ATGCAT 1 cut(s) 6
FaeI CATG 4 cut(s) 191, 248, 335, 412
FaiI YATR 7 cut(s) 108, 189, 246, 315, 333, 410, 482
FatI CATG 4 cut(s) 187, 244, 331, 408
FblI GTMKAC 2 cut(s) 166, 336
Fnu4HI GCNGC 1 cut(s) 319
FokI GGATG 3 cut(s) 132, 266, 398
Fsp4HI GCNGC 1 cut(s) 319
FspBI CTAG 3 cut(s) 33, 438, 468
GluI GCNGC 1 cut(s) 319
HaeIII GGCC 1 cut(s) 176
Hin1II CATG 4 cut(s) 191, 248, 335, 412
HindIII AAGCTT 1 cut(s) 144
HinfI GANTC 2 cut(s) 77, 215
Hpy166II GTNNAC 2 cut(s) 167, 337
Hpy188I TCNGA 1 cut(s) 490
Hpy8I GTNNAC 2 cut(s) 167, 337
HpyAV CCTTC 1 cut(s) 143
HpyCH4V TGCA 4 cut(s) 4, 262, 313, 389
HpyF3I CTNAG 2 cut(s) 219, 489
Hsp92II CATG 4 cut(s) 191, 248, 335, 412
Kzo9I GATC 2 cut(s) 125, 322
LmnI GCTCC 1 cut(s) 412
LpnPI CCDG 8 cut(s) 84, 122, 146, 188, 206, 254, 338, 467
Lsp1109I GCAGC 1 cut(s) 305
LweI GCATC 2 cut(s) 110, 376
MaeI CTAG 3 cut(s) 33, 438, 468
MaeIII GTNAC 1 cut(s) 153
MalI GATC 2 cut(s) 127, 324
MboI GATC 2 cut(s) 125, 322
MboII GAAGA 1 cut(s) 191
MfeI CAATTG 1 cut(s) 308
MflI RGATCY 1 cut(s) 125
MlsI TGGCCA 1 cut(s) 176
MluCI AATT 7 cut(s) 14, 51, 308, 374, 433, 471, 484
MluNI TGGCCA 1 cut(s) 176
MnlI CCTC 3 cut(s) 245, 308, 432
Mox20I TGGCCA 1 cut(s) 176
Mph1103I ATGCAT 1 cut(s) 6
MscI TGGCCA 1 cut(s) 176
MseI TTAA 8 cut(s) 12, 17, 42, 71, 269, 327, 348, 432
Msp20I TGGCCA 1 cut(s) 176
MspCI CTTAAG 2 cut(s) 70, 326
MunI CAATTG 1 cut(s) 308
MvnI CGCG 1 cut(s) 342
NdeII GATC 2 cut(s) 125, 322
NlaIII CATG 4 cut(s) 191, 248, 335, 412
NsiI ATGCAT 1 cut(s) 6
NspI RCATGY 1 cut(s) 335
PfeI GAWTC 2 cut(s) 77, 215
PkrI GCNGC 1 cut(s) 320
PshBI ATTAAT 1 cut(s) 42
PsuI RGATCY 1 cut(s) 125
SaqAI TTAA 8 cut(s) 12, 17, 42, 71, 269, 327, 348, 432
SatI GCNGC 1 cut(s) 319
Sau3AI GATC 2 cut(s) 125, 322
SetI ASST 7 cut(s) 148, 225, 320, 357, 443, 456, 495
SfaNI GCATC 2 cut(s) 110, 376
SmlI CTYRAG 2 cut(s) 70, 326
SmoI CTYRAG 2 cut(s) 70, 326
Sse9I AATT 7 cut(s) 14, 51, 308, 374, 433, 471, 484
SsiI CCGC 4 cut(s) 63, 123, 140, 340
SspMI CTAG 3 cut(s) 33, 438, 468
TasI AATT 7 cut(s) 14, 51, 308, 374, 433, 471, 484
TfiI GAWTC 2 cut(s) 77, 215
Tru1I TTAA 8 cut(s) 12, 17, 42, 71, 269, 327, 348, 432
Tru9I TTAA 8 cut(s) 12, 17, 42, 71, 269, 327, 348, 432
TseI GCWGC 1 cut(s) 318
TspDTI ATGAA 2 cut(s) 392, 397
Vha464I CTTAAG 2 cut(s) 70, 326
VspI ATTAAT 1 cut(s) 42
XapI RAATTY 2 cut(s) 374, 484
XceI RCATGY 1 cut(s) 335
XcmI CCANNNNNNNNNTGG 1 cut(s) 379
XmiI GTMKAC 2 cut(s) 166, 336
XspI CTAG 3 cut(s) 33, 438, 468
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.