RchiOBHm_Chr1g0319821

Ribonuclease H protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
7455941 .. 7456427
487 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 300 bp
ATGGCTTCTGCCTCCCAATGCCATCATCTTTTGGTTGAGTGTGATTCTGAGGTCCTGGTGAGTTTAATCAATCATGGAGTGGATGAGTTACATCCTCTAAAAACGATCATTGATTGCTGCAATTCTTTGAGAAGACAGTTCTGGAGTTGTGAGATAACACATGTTTATAGGGAAATTAACCAGGTTGCTGATGTGCTTTCCAAGGCTGGTTTGGACACTGACATTGGAGTGATGCCTCCTCCACAAGTGATGCCTTCCTTGATGACTTGTGTGAAAGTCCTATCTGCTTCTGATATGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

99

Amino Acids

10.94

Weight (kDa)

5.08

Isoelectric Point (pI)

45.61

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RVT_3 PF13456 2 - 69 3e-14 Reverse transcriptase-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000890)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AflIII ACRYGT 1 cut(s) 160
AjnI CCWGG 2 cut(s) 54, 180
ApeKI GCWGC 1 cut(s) 117
AspS9I GGNCC 1 cut(s) 52
AsuHPI GGTGA 1 cut(s) 70
AvaII GGWCC 1 cut(s) 52
BbsI GAAGAC 1 cut(s) 139
BbvI GCAGC 1 cut(s) 104
BccI CCATC 1 cut(s) 30
BciT130I CCWGG 2 cut(s) 56, 182
BisI GCNGC 1 cut(s) 118
BlsI GCNGC 1 cut(s) 119
Bme1390I CCNGG 2 cut(s) 56, 182
Bme18I GGWCC 1 cut(s) 52
BmgT120I GGNCC 1 cut(s) 52
BmrFI CCNGG 2 cut(s) 56, 182
BmsI GCATC 2 cut(s) 222, 240
BpiI GAAGAC 1 cut(s) 139
BpmI CTGGAG 1 cut(s) 163
BsaJI CCNNGG 1 cut(s) 201
BseBI CCWGG 2 cut(s) 56, 182
BseDI CCNNGG 1 cut(s) 201
BseGI GGATG 2 cut(s) 88, 91
BseMII CTCAG 1 cut(s) 39
BseRI GAGGAG 1 cut(s) 228
BseXI GCAGC 1 cut(s) 104
Bsp143I GATC 1 cut(s) 105
BspCNI CTCAG 1 cut(s) 40
BssECI CCNNGG 1 cut(s) 201
BssMI GATC 1 cut(s) 105
BssT1I CCWWGG 1 cut(s) 201
Bst2UI CCWGG 2 cut(s) 56, 182
Bst4CI ACNGT 1 cut(s) 138
BstDEI CTNAG 1 cut(s) 48
BstF5I GGATG 2 cut(s) 88, 91
BstKTI GATC 1 cut(s) 108
BstMBI GATC 1 cut(s) 105
BstNI CCWGG 2 cut(s) 56, 182
BstNSI RCATGY 1 cut(s) 164
BstSCI CCNGG 2 cut(s) 54, 180
BstV1I GCAGC 1 cut(s) 104
BstV2I GAAGAC 1 cut(s) 139
BtsCI GGATG 2 cut(s) 88, 91
BtsIMutI CAGTG 1 cut(s) 216
Cfr13I GGNCC 1 cut(s) 52
CsiI ACCWGGT 1 cut(s) 180
CviAII CATG 2 cut(s) 74, 161
CviJI RGCY 2 cut(s) 5, 206
CviKI_1 RGCY 2 cut(s) 5, 206
DdeI CTNAG 1 cut(s) 48
DpnI GATC 1 cut(s) 107
DpnII GATC 1 cut(s) 105
Eco130I CCWWGG 1 cut(s) 201
Eco47I GGWCC 1 cut(s) 52
EcoO109I RGGNCCY 1 cut(s) 52
EcoRII CCWGG 2 cut(s) 54, 180
EcoT14I CCWWGG 1 cut(s) 201
ErhI CCWWGG 1 cut(s) 201
FaeI CATG 2 cut(s) 77, 164
FaiI YATR 4 cut(s) 75, 162, 168, 296
FatI CATG 2 cut(s) 73, 160
Fnu4HI GCNGC 1 cut(s) 118
FokI GGATG 2 cut(s) 78, 95
Fsp4HI GCNGC 1 cut(s) 118
GluI GCNGC 1 cut(s) 118
GsuI CTGGAG 1 cut(s) 163
Hin1II CATG 2 cut(s) 77, 164
HinfI GANTC 1 cut(s) 44
HphI GGTGA 1 cut(s) 70
Hpy188I TCNGA 2 cut(s) 49, 292
Hpy188III TCNNGA 1 cut(s) 142
HpyAV CCTTC 1 cut(s) 264
HpyCH4III ACNGT 1 cut(s) 138
HpyCH4V TGCA 1 cut(s) 120
HpyF3I CTNAG 1 cut(s) 48
Hsp92II CATG 2 cut(s) 77, 164
Kzo9I GATC 1 cut(s) 105
LpnPI CCDG 6 cut(s) 41, 68, 127, 167, 192, 194
Lsp1109I GCAGC 1 cut(s) 104
LweI GCATC 2 cut(s) 222, 240
MabI ACCWGGT 1 cut(s) 180
MaeIII GTNAC 1 cut(s) 87
MalI GATC 1 cut(s) 107
MboI GATC 1 cut(s) 105
MboII GAAGA 1 cut(s) 144
MluCI AATT 2 cut(s) 121, 174
MnlI CCTC 5 cut(s) 22, 43, 105, 246, 249
MseI TTAA 2 cut(s) 65, 177
MslI CAYNNNNRTG 1 cut(s) 227
MspR9I CCNGG 2 cut(s) 56, 182
MvaI CCWGG 2 cut(s) 56, 182
NdeII GATC 1 cut(s) 105
NlaIII CATG 2 cut(s) 77, 164
NspI RCATGY 1 cut(s) 164
PciI ACATGT 1 cut(s) 160
PfeI GAWTC 1 cut(s) 44
PkrI GCNGC 1 cut(s) 119
PpuMI RGGWCCY 1 cut(s) 52
PscI ACATGT 1 cut(s) 160
Psp5II RGGWCCY 1 cut(s) 52
Psp6I CCWGG 2 cut(s) 54, 180
PspGI CCWGG 2 cut(s) 54, 180
PspPI GGNCC 1 cut(s) 52
PspPPI RGGWCCY 1 cut(s) 52
RseI CAYNNNNRTG 1 cut(s) 227
SaqAI TTAA 2 cut(s) 65, 177
SatI GCNGC 1 cut(s) 118
Sau3AI GATC 1 cut(s) 105
Sau96I GGNCC 1 cut(s) 52
ScrFI CCNGG 2 cut(s) 56, 182
SetI ASST 2 cut(s) 54, 186
SexAI ACCWGGT 1 cut(s) 180
SfaNI GCATC 2 cut(s) 222, 240
SinI GGWCC 1 cut(s) 52
SmiMI CAYNNNNRTG 1 cut(s) 227
Sse9I AATT 2 cut(s) 121, 174
StyD4I CCNGG 2 cut(s) 54, 180
StyI CCWWGG 1 cut(s) 201
TaaI ACNGT 1 cut(s) 138
TasI AATT 2 cut(s) 121, 174
TfiI GAWTC 1 cut(s) 44
Tru1I TTAA 2 cut(s) 65, 177
Tru9I TTAA 2 cut(s) 65, 177
TscAI CASTG 1 cut(s) 223
TseI GCWGC 1 cut(s) 117
TspRI CASTG 1 cut(s) 223
VpaK11BI GGWCC 1 cut(s) 52
XceI RCATGY 1 cut(s) 164
XcmI CCANNNNNNNNNTGG 1 cut(s) 208
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.