RchiOBHm_Chr1g0346791

UPF0481 protein At3g47200-like

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
39336546 .. 39336920
375 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 375 bp
ATGGCACTGGAGCAGTTTGTCTACCCAGAGGAGGCTTTTGTTTGCAATTATTTTTTGATGATGGACAAACTTGTGGACACTGTGGAAGATGTGGATTTTCTGGTGGAGAAAGGAGTGATCGTCAACATGCTAGGAAGTAACCAACAAGTGGCGCAGTTGGTTAATAAACTTTGCGATCATATCATGGAAGAAAAATCCTGCTATAATCATATCTGTAAAAAGCTCAATACGCGCTACGAGAGTTCTCTTAACCGACATTTGGTATCCTTGAGAAAAGTTTACTTCAAGGATGTCTGGACAGGCAGTGCAACTTTTTTTGGAGTTGTACTCGTAGTTCTCACAATCGTTGAAATCATTATGTCATTCAGACAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

124

Amino Acids

14.41

Weight (kDa)

5.55

Isoelectric Point (pI)

32.26

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF247 PF03140 1 - 113 9.7e-31 Plant protein of unknown function
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 148
AccI GTMKAC 1 cut(s) 21
AccII CGCG 1 cut(s) 232
AfaI GTAC 1 cut(s) 327
AfiI CCNNNNNNNGG 3 cut(s) 31, 148, 259
AgsI TTSAA 2 cut(s) 286, 350
AluBI AGCT 1 cut(s) 223
AluI AGCT 1 cut(s) 223
AspLEI GCGC 2 cut(s) 154, 234
BccI CCATC 1 cut(s) 55
BciVI GTATCC 1 cut(s) 274
BfaI CTAG 1 cut(s) 131
BfuI GTATCC 1 cut(s) 274
BplI GAGNNNNNCTC 2 cut(s) 312, 344
BpmI CTGGAG 1 cut(s) 29
BpuEI CTTGAG 1 cut(s) 289
BsaXI ACNNNNNCTCC 2 cut(s) 105, 135
Bsc4I CCNNNNNNNGG 3 cut(s) 31, 148, 259
Bse1I ACTGG 1 cut(s) 12
BseGI GGATG 1 cut(s) 295
BseLI CCNNNNNNNGG 3 cut(s) 31, 148, 259
BseNI ACTGG 1 cut(s) 12
BseRI GAGGAG 1 cut(s) 44
Bsh1236I CGCG 1 cut(s) 232
BslI CCNNNNNNNGG 3 cut(s) 31, 148, 259
Bsp143I GATC 2 cut(s) 117, 175
BspFNI CGCG 1 cut(s) 232
BsrI ACTGG 1 cut(s) 12
BssMI GATC 2 cut(s) 117, 175
Bst4CI ACNGT 2 cut(s) 82, 372
BstF5I GGATG 1 cut(s) 295
BstFNI CGCG 1 cut(s) 232
BstHHI GCGC 2 cut(s) 154, 234
BstKTI GATC 2 cut(s) 120, 178
BstMBI GATC 2 cut(s) 117, 175
BstMWI GCNNNNNNNGC 1 cut(s) 229
BstNSI RCATGY 1 cut(s) 130
BstUI CGCG 1 cut(s) 232
BsuI GTATCC 1 cut(s) 274
BtsCI GGATG 1 cut(s) 295
BtsI GCAGTG 1 cut(s) 310
BtsIMutI CAGTG 3 cut(s) 5, 78, 310
CfoI GCGC 2 cut(s) 154, 234
Csp6I GTAC 1 cut(s) 326
CviAII CATG 2 cut(s) 127, 184
CviJI RGCY 2 cut(s) 35, 223
CviKI_1 RGCY 2 cut(s) 35, 223
CviQI GTAC 1 cut(s) 326
DpnI GATC 2 cut(s) 119, 177
DpnII GATC 2 cut(s) 117, 175
FaeI CATG 2 cut(s) 130, 187
FaiI YATR 6 cut(s) 128, 180, 185, 204, 210, 359
FatI CATG 2 cut(s) 126, 183
FblI GTMKAC 1 cut(s) 21
FokI GGATG 1 cut(s) 302
FspBI CTAG 1 cut(s) 131
GlaI GCGC 2 cut(s) 153, 233
GsuI CTGGAG 1 cut(s) 29
HhaI GCGC 2 cut(s) 154, 234
Hin1II CATG 2 cut(s) 130, 187
Hin6I GCGC 2 cut(s) 152, 232
HinP1I GCGC 2 cut(s) 152, 232
HincII GTYRAC 1 cut(s) 124
HindII GTYRAC 1 cut(s) 124
Hpy166II GTNNAC 4 cut(s) 22, 76, 124, 280
Hpy188I TCNGA 1 cut(s) 368
Hpy188III TCNNGA 1 cut(s) 295
Hpy8I GTNNAC 4 cut(s) 22, 76, 124, 280
HpyCH4III ACNGT 2 cut(s) 82, 372
HpyCH4V TGCA 2 cut(s) 45, 308
HpyF10VI GCNNNNNNNGC 1 cut(s) 229
Hsp92II CATG 2 cut(s) 130, 187
HspAI GCGC 2 cut(s) 152, 232
Kzo9I GATC 2 cut(s) 117, 175
LmnI GCTCC 1 cut(s) 10
LpnPI CCDG 5 cut(s) 39, 86, 211, 280, 285
MaeI CTAG 1 cut(s) 131
MaeIII GTNAC 1 cut(s) 137
MalI GATC 2 cut(s) 119, 177
MboI GATC 2 cut(s) 117, 175
MboII GAAGA 2 cut(s) 98, 200
MluCI AATT 1 cut(s) 46
MnlI CCTC 2 cut(s) 22, 25
MseI TTAA 2 cut(s) 162, 249
MvnI CGCG 1 cut(s) 232
MwoI GCNNNNNNNGC 1 cut(s) 229
NdeII GATC 2 cut(s) 117, 175
NlaIII CATG 2 cut(s) 130, 187
NspI RCATGY 1 cut(s) 130
PflMI CCANNNNNTGG 1 cut(s) 148
PsrI GAACNNNNNNTAC 2 cut(s) 318, 350
RsaI GTAC 1 cut(s) 327
RsaNI GTAC 1 cut(s) 326
SaqAI TTAA 2 cut(s) 162, 249
Sau3AI GATC 2 cut(s) 117, 175
SetI ASST 1 cut(s) 225
SmlI CTYRAG 1 cut(s) 268
SmoI CTYRAG 1 cut(s) 268
Sse9I AATT 1 cut(s) 46
SspMI CTAG 1 cut(s) 131
TaaI ACNGT 2 cut(s) 82, 372
TasI AATT 1 cut(s) 46
TatI WGTACW 1 cut(s) 325
Tru1I TTAA 2 cut(s) 162, 249
Tru9I TTAA 2 cut(s) 162, 249
TscAI CASTG 3 cut(s) 12, 85, 310
TspRI CASTG 3 cut(s) 12, 85, 310
Van91I CCANNNNNTGG 1 cut(s) 148
XceI RCATGY 1 cut(s) 130
XmiI GTMKAC 1 cut(s) 21
XspI CTAG 1 cut(s) 131
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.