Basic Information

Type: gene

Biological Identity

Species

rosa_wichuraiana

Chromosome

Chr4

Orthogroup ID

OG0000821

Physical Location & Seq

Genomic Coordinates Forward (+)

2958673 .. 2959650

Gene Structure 978 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rw4G001590.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 870 bp

ATGGTAGAACCTCAGAGTGAACAAAGAGAGAATGCACCCGTATTGTTCTTGCAGGAATGGTGTATCTATAGGTTTCCCAGCCAGCTCCGCAATGTAGATGAAGCAGCATACACTCCTCAAACACTTTCAATAGGGCCTTTCCACCATGGAAATCCAAAACTGAGGGACATGGAGGCAGGTACCTTTAAATGTGAGATCGACTTTTTGAACCTCATCCTAGTTGACGCCTGCTTCATAATTGAACTCTTTTTGACTAATTCTGAACAAGAACAACATAATGCAAATTATTATATACTGAGATCACCGTGGCTGAGGAAAACGGTGGAGAGGGACCTGATACTGTTGGAAAATCAGCTTCCTTATTTTCTTCTTCAAAAGCTATATGACTTTGCCATACCTACCTTTTCCAATGGCCATCTTGGCAATGGAGACCAAGCACAAGTTGGGGGACATGTCCATAAAGATAGCTCCAACAGTCAGCAATGCTGCTTCCCTTGCTTCCGGCCCGGTGATTTTCAAGAGAACTCCATCCGATCTGAACCTATTCAACATACCTGTAAGTTTTTTAAGGCATACACTGAGGGAAAATCTGTCGGGAATGGATTTGAGCCAAAACACTTCACTGATATGGTTAGACACTTTCTATGCCCGTGCAAGGAGCTGTTGTGGGTCAAAAATTATGATCAGCCCGTCAAAATTAAATACCATGCAAAAAAGCTGAAGGTTGCAGGAGTGAAGTTTATGCCACTTAGAGAACCATTTGTTATAAAGGAAGACCCTGTGTTGACGTTTAACCCAGCATGTTTGGCACATAAGGAGTTGAAGCTTACAAGACTTTGGGCAGAGTATGAGGCAGAATGCCTTTTTTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF247

Protein Analysis

289

Amino Acids

33.63

Weight (kDa)

6.42

Isoelectric Point (pI)

50.71

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
DUF247	PF03140	22 - 59	1e-10	Plant protein of unknown function
DUF247	PF03140	65 - 289	3e-24	Plant protein of unknown function

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000821)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G65985 AT1G65985 AT1G67150 AT1G67150 AT1G67150 AT1G67150 AT2G28580 AT2G28580 AT2G28580 AT2G28580 AT2G28580 AT2G28580 AT2G44930 AT3G60470
fragaria_vesca	FvH4_7g09691 FvH4_7g09700 FvH4_7g09710
malus_domestica	MD00G1041300.v1.1
prunus_persica	Prupe.2G124600_v2.0.a1 Prupe.2G124800_v2.0.a1 Prupe.2G124900_v2.0.a1 Prupe.2G125100_v2.0.a1 Prupe.2G125200_v2.0.a1 Prupe.2G125200_v2.0.a1 Prupe.2G125200_v2.0.a1 Prupe.2G125400_v2.0.a1 Prupe.2G125400_v2.0.a1
pyrus_communis	pycom02g17910 pycom02g18260 pycom02g18340
rosa_chinensis	RchiOBHm_Chr1g0346611 RchiOBHm_Chr1g0346641 RchiOBHm_Chr1g0346651 RchiOBHm_Chr1g0346791 RchiOBHm_Chr4g0388531
rosa_laevigata	RLG00000010045 RLG00000010060 RLG00000028784 RLG00000028788 RLG00000028789
rosa_multiflora	Rmu_sc0001241.1_g000008 Rmu_sc0001241.1_g000009 Rmu_sc0002357.1_g000013 Rmu_sc0002640.1_g000020 Rmu_sc0005167.1_g000027 Rmu_sc0006463.1_g000009 Rmu_sc0006463.1_g000017
rosa_roxburghii	Rroxscaffold_4G00308200 Rroxscaffold_4G00308310 Rroxscaffold_4G00308390 Rroxscaffold_5G00334860 Rroxscaffold_5G00334990
rosa_rugosa	Rorug01G0181400 Rorug01G0181700 Rorug01G0182300 Rorug03G0318400
rosa_samantha	Rh1AG200700 Rh1BG166900 Rh1BG167000 Rh1BG167700 Rh1DG197800 Rh1DG198500 Rh4BG016600 Rh4DG017100
rosa_wichuraiana	Rw1G016810 Rw1G016820 Rw4G001580 Rw4G001590

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	767
Acc36I	ACCTGC	1 cut(s)	167
Acc65I	GGTACC	1 cut(s)	179
AccB1I	GGYRCC	1 cut(s)	179
AciI	CCGC	1 cut(s)	88
AcoI	YGGCCR	1 cut(s)	412
AcuI	CTGAAG	1 cut(s)	740
AcyI	GRCGYC	1 cut(s)	225
AfaI	GTAC	1 cut(s)	181
AfiI	CCNNNNNNNGG	1 cut(s)	655
AflIII	ACRYGT	1 cut(s)	451
AgsI	TTSAA	7 cut(s)	129, 208, 242, 374, 518, 548, 823
AluBI	AGCT	7 cut(s)	85, 355, 379, 468, 661, 718, 826
AluI	AGCT	7 cut(s)	85, 355, 379, 468, 661, 718, 826
Alw26I	GTCTC	1 cut(s)	423
AoxI	GGCC	3 cut(s)	134, 412, 503
ApeKI	GCWGC	2 cut(s)	104, 486
Asp700I	GAANNNNTTC	1 cut(s)	543
Asp718I	GGTACC	1 cut(s)	179
AspS9I	GGNCC	3 cut(s)	134, 331, 504
AsuC2I	CCSGG	1 cut(s)	507
AsuHPI	GGTGA	2 cut(s)	294, 521
AvaII	GGWCC	1 cut(s)	331
BalI	TGGCCA	1 cut(s)	414
BanI	GGYRCC	1 cut(s)	179
BbsI	GAAGAC	1 cut(s)	780
BbvCI	CCTCAGC	1 cut(s)	311
BbvI	GCAGC	2 cut(s)	116, 473
BccI	CCATC	2 cut(s)	423, 536
BclI	TGATCA	1 cut(s)	682
BcnI	CCSGG	1 cut(s)	507
BcoDI	GTCTC	1 cut(s)	423
BfaI	CTAG	1 cut(s)	218
BfmI	CTRYAG	1 cut(s)	67
BfuAI	ACCTGC	1 cut(s)	167
BglI	GCCNNNNNGGC	1 cut(s)	420
BisI	GCNGC	2 cut(s)	105, 487
BlsI	GCNGC	2 cut(s)	106, 488
Bme1390I	CCNGG	1 cut(s)	507
Bme18I	GGWCC	1 cut(s)	331
BmgT120I	GGNCC	3 cut(s)	134, 331, 504
BmiI	GGNNCC	2 cut(s)	181, 332
BmrFI	CCNGG	1 cut(s)	507
BpiI	GAAGAC	1 cut(s)	780
Bpu10I	CCTNAGC	1 cut(s)	311
BpuMI	CCSGG	1 cut(s)	507
BsaHI	GRCGYC	1 cut(s)	225
BsaI	GGTCTC	1 cut(s)	423
BsaJI	CCNNGG	2 cut(s)	145, 305
BsaXI	ACNNNNNCTCC	2 cut(s)	650, 680
Bsc4I	CCNNNNNNNGG	1 cut(s)	655
Bse3DI	GCAATG	3 cut(s)	97, 430, 488
BseDI	CCNNGG	2 cut(s)	145, 305
BseGI	GGATG	2 cut(s)	213, 528
BseLI	CCNNNNNNNGG	1 cut(s)	655
BseMI	GCAATG	3 cut(s)	97, 430, 488
BseMII	CTCAG	5 cut(s)	26, 152, 287, 302, 570
BseRI	GAGGAG	1 cut(s)	105
BseXI	GCAGC	2 cut(s)	116, 473
BseYI	CCCAGC	2 cut(s)	77, 796
BshFI	GGCC	3 cut(s)	136, 414, 505
BshNI	GGYRCC	1 cut(s)	179
BsiSI	CCGG	2 cut(s)	502, 507
BslFI	GGGAC	3 cut(s)	179, 344, 462
BslI	CCNNNNNNNGG	1 cut(s)	655
BsmAI	GTCTC	1 cut(s)	423
BsmFI	GGGAC	3 cut(s)	179, 344, 462
BsmI	GAATGC	2 cut(s)	37, 863
BsnI	GGCC	3 cut(s)	136, 414, 505
Bso31I	GGTCTC	1 cut(s)	423
Bsp143I	GATC	4 cut(s)	195, 299, 533, 682
Bsp19I	CCATGG	1 cut(s)	145
BspACI	CCGC	1 cut(s)	88
BspANI	GGCC	3 cut(s)	136, 414, 505
BspCNI	CTCAG	5 cut(s)	25, 153, 288, 303, 571
BspLI	GGNNCC	2 cut(s)	181, 332
BspMI	ACCTGC	1 cut(s)	167
BspT107I	GGYRCC	1 cut(s)	179
BspTNI	GGTCTC	1 cut(s)	423
BsrDI	GCAATG	3 cut(s)	97, 430, 488
BssECI	CCNNGG	2 cut(s)	145, 305
BssMI	GATC	4 cut(s)	195, 299, 533, 682
BssNI	GRCGYC	1 cut(s)	225
BssT1I	CCWWGG	1 cut(s)	145
Bst4CI	ACNGT	4 cut(s)	306, 322, 342, 476
BstACI	GRCGYC	1 cut(s)	225
BstC8I	GCNNGC	2 cut(s)	83, 229
BstDEI	CTNAG	6 cut(s)	12, 161, 296, 311, 579, 749
BstDSI	CCRYGG	2 cut(s)	145, 305
BstF5I	GGATG	2 cut(s)	213, 528
BstKTI	GATC	4 cut(s)	198, 302, 536, 685
BstMAI	GTCTC	1 cut(s)	423
BstMBI	GATC	4 cut(s)	195, 299, 533, 682
BstMWI	GCNNNNNNNGC	4 cut(s)	87, 420, 495, 806
BstNSI	RCATGY	2 cut(s)	455, 804
BstSCI	CCNGG	1 cut(s)	505
BstSFI	CTRYAG	1 cut(s)	67
BstV1I	GCAGC	2 cut(s)	116, 473
BstV2I	GAAGAC	1 cut(s)	780
BsuRI	GGCC	3 cut(s)	136, 414, 505
BtgI	CCRYGG	2 cut(s)	145, 305
BtsCI	GGATG	2 cut(s)	213, 528
BtsIMutI	CAGTG	2 cut(s)	576, 621
BveI	ACCTGC	1 cut(s)	167
Cac8I	GCNNGC	2 cut(s)	83, 229
Cfr13I	GGNCC	3 cut(s)	134, 331, 504
CseI	GACGC	1 cut(s)	233
Csp6I	GTAC	1 cut(s)	180
CviAII	CATG	5 cut(s)	146, 169, 452, 707, 801
CviQI	GTAC	1 cut(s)	180
DdeI	CTNAG	6 cut(s)	12, 161, 296, 311, 579, 749
DpnI	GATC	4 cut(s)	197, 301, 535, 684
DpnII	GATC	4 cut(s)	195, 299, 533, 682
DraI	TTTAAA	1 cut(s)	187
EaeI	YGGCCR	1 cut(s)	412
Eco130I	CCWWGG	1 cut(s)	145
Eco31I	GGTCTC	1 cut(s)	423
Eco47I	GGWCC	1 cut(s)	331
Eco57I	CTGAAG	1 cut(s)	740
EcoO109I	RGGNCCY	2 cut(s)	134, 331
EcoT14I	CCWWGG	1 cut(s)	145
ErhI	CCWWGG	1 cut(s)	145
FaeI	CATG	5 cut(s)	149, 172, 455, 710, 804
FaqI	GGGAC	3 cut(s)	179, 344, 462
FatI	CATG	5 cut(s)	145, 168, 451, 706, 800
FbaI	TGATCA	1 cut(s)	682
Fnu4HI	GCNGC	2 cut(s)	105, 487
FokI	GGATG	2 cut(s)	200, 515
Fsp4HI	GCNGC	2 cut(s)	105, 487
FspBI	CTAG	1 cut(s)	218
GluI	GCNGC	2 cut(s)	105, 487
GsaI	CCCAGC	2 cut(s)	81, 800
HaeIII	GGCC	3 cut(s)	136, 414, 505
HapII	CCGG	2 cut(s)	502, 507
HgaI	GACGC	1 cut(s)	233
Hin1I	GRCGYC	1 cut(s)	225
Hin1II	CATG	5 cut(s)	149, 172, 455, 710, 804
HincII	GTYRAC	2 cut(s)	223, 786
HindII	GTYRAC	2 cut(s)	223, 786
HindIII	AAGCTT	1 cut(s)	824
HpaII	CCGG	2 cut(s)	502, 507
HphI	GGTGA	2 cut(s)	294, 521
Hpy166II	GTNNAC	3 cut(s)	20, 223, 786
Hpy188I	TCNGA	4 cut(s)	15, 262, 533, 538
Hpy188III	TCNNGA	2 cut(s)	518, 595
Hpy8I	GTNNAC	3 cut(s)	20, 223, 786
HpyAV	CCTTC	1 cut(s)	715
HpyCH4III	ACNGT	4 cut(s)	306, 322, 342, 476
HpyCH4IV	ACGT	1 cut(s)	788
HpyCH4V	TGCA	6 cut(s)	35, 52, 281, 654, 710, 728
HpyF10VI	GCNNNNNNNGC	4 cut(s)	87, 420, 495, 806
HpyF3I	CTNAG	6 cut(s)	12, 161, 296, 311, 579, 749
HpySE526I	ACGT	1 cut(s)	788
Hsp92I	GRCGYC	1 cut(s)	225
Hsp92II	CATG	5 cut(s)	149, 172, 455, 710, 804
KpnI	GGTACC	1 cut(s)	183
Ksp22I	TGATCA	1 cut(s)	682
Kzo9I	GATC	4 cut(s)	195, 299, 533, 682
LmnI	GCTCC	3 cut(s)	90, 473, 658
Lsp1109I	GCAGC	2 cut(s)	116, 473
MaeI	CTAG	1 cut(s)	218
MaeII	ACGT	1 cut(s)	788
MalI	GATC	4 cut(s)	197, 301, 535, 684
MboI	GATC	4 cut(s)	195, 299, 533, 682
MboII	GAAGA	3 cut(s)	359, 362, 785
MlsI	TGGCCA	1 cut(s)	414
MluCI	AATT	5 cut(s)	237, 256, 283, 676, 696
MluNI	TGGCCA	1 cut(s)	414
MmeI	TCCRAC	2 cut(s)	324, 495
MnlI	CCTC	9 cut(s)	21, 126, 156, 166, 221, 306, 321, 574, 844
Mox20I	TGGCCA	1 cut(s)	414
MroXI	GAANNNNTTC	1 cut(s)	543
MscI	TGGCCA	1 cut(s)	414
MseI	TTAA	4 cut(s)	186, 567, 699, 792
MslI	CAYNNNNRTG	1 cut(s)	626
Msp20I	TGGCCA	1 cut(s)	414
MspI	CCGG	2 cut(s)	502, 507
MspR9I	CCNGG	1 cut(s)	507
Mva1269I	GAATGC	2 cut(s)	37, 863
MwoI	GCNNNNNNNGC	4 cut(s)	87, 420, 495, 806
NciI	CCSGG	1 cut(s)	507
NcoI	CCATGG	1 cut(s)	145
NdeII	GATC	4 cut(s)	195, 299, 533, 682
NlaIII	CATG	5 cut(s)	149, 172, 455, 710, 804
NlaIV	GGNNCC	2 cut(s)	181, 332
NspI	RCATGY	2 cut(s)	455, 804
PciI	ACATGT	1 cut(s)	451
PctI	GAATGC	2 cut(s)	37, 863
PdmI	GAANNNNTTC	1 cut(s)	543
PkrI	GCNGC	2 cut(s)	106, 488
PpuMI	RGGWCCY	1 cut(s)	331
PscI	ACATGT	1 cut(s)	451
PsiI	TTATAA	1 cut(s)	767
Psp5II	RGGWCCY	1 cut(s)	331
PspFI	CCCAGC	2 cut(s)	77, 796
PspN4I	GGNNCC	2 cut(s)	181, 332
PspPI	GGNCC	3 cut(s)	134, 331, 504
PspPPI	RGGWCCY	1 cut(s)	331
RsaI	GTAC	1 cut(s)	181
RsaNI	GTAC	1 cut(s)	180
RseI	CAYNNNNRTG	1 cut(s)	626
SaqAI	TTAA	4 cut(s)	186, 567, 699, 792
SatI	GCNGC	2 cut(s)	105, 487
Sau3AI	GATC	4 cut(s)	195, 299, 533, 682
Sau96I	GGNCC	3 cut(s)	134, 331, 504
ScrFI	CCNGG	1 cut(s)	507
SfcI	CTRYAG	1 cut(s)	67
SinI	GGWCC	1 cut(s)	331
SmiMI	CAYNNNNRTG	1 cut(s)	626
Sse9I	AATT	5 cut(s)	237, 256, 283, 676, 696
SsiI	CCGC	1 cut(s)	88
SspMI	CTAG	1 cut(s)	218
StyD4I	CCNGG	1 cut(s)	505
StyI	CCWWGG	1 cut(s)	145
TaaI	ACNGT	4 cut(s)	306, 322, 342, 476
TaiI	ACGT	1 cut(s)	791
TaqI	TCGA	1 cut(s)	198
TasI	AATT	5 cut(s)	237, 256, 283, 676, 696
Tru1I	TTAA	4 cut(s)	186, 567, 699, 792
Tru9I	TTAA	4 cut(s)	186, 567, 699, 792
TscAI	CASTG	2 cut(s)	583, 628
TseI	GCWGC	2 cut(s)	104, 486
TspDTI	ATGAA	2 cut(s)	114, 223
TspRI	CASTG	2 cut(s)	583, 628
VpaK11BI	GGWCC	1 cut(s)	331
XceI	RCATGY	2 cut(s)	455, 804
XcmI	CCANNNNNNNNNTGG	2 cut(s)	422, 440
XmnI	GAANNNNTTC	1 cut(s)	543
XspI	CTAG	1 cut(s)	218

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.