RchiOBHm_Chr5g0072551

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
OG0000891
Physical Location & Seq
Forward (+)
78596999 .. 78597633
635 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ34751

Sequence Viewer

Length: 132 bp
ATGTTGTTATGCATAGACATCACTTACAGATTGAATGTTTTTGCAGAACACATGCTCTTCATGGGGAGTACTAAGTTCCCAGATGAAAATGAGAAAACTCTGTCCTCATTGCTATGTTATCACCTGTTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

43

Amino Acids

5.09

Weight (kDa)

5.38

Isoelectric Point (pI)

14.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 70
AgsI TTSAA 1 cut(s) 34
AsuHPI GGTGA 1 cut(s) 113
BmcAI AGTACT 1 cut(s) 70
Bse3DI GCAATG 1 cut(s) 107
BseMI GCAATG 1 cut(s) 107
BspQI GCTCTTC 1 cut(s) 62
BsrDI GCAATG 1 cut(s) 107
Bst6I CTCTTC 1 cut(s) 62
BstDEI CTNAG 1 cut(s) 72
BstNSI RCATGY 1 cut(s) 55
Csp6I GTAC 1 cut(s) 69
CviAII CATG 2 cut(s) 52, 61
CviQI GTAC 1 cut(s) 69
DdeI CTNAG 1 cut(s) 72
Eam1104I CTCTTC 1 cut(s) 62
EarI CTCTTC 1 cut(s) 62
EcoT22I ATGCAT 1 cut(s) 14
FaeI CATG 2 cut(s) 55, 64
FaiI YATR 5 cut(s) 10, 14, 53, 62, 115
FatI CATG 2 cut(s) 51, 60
FspEI CC 6 cut(s) 47, 48, 49, 92, 93, 118
Hin1II CATG 2 cut(s) 55, 64
HphI GGTGA 1 cut(s) 113
HpyCH4V TGCA 2 cut(s) 12, 44
HpyF3I CTNAG 1 cut(s) 72
Hsp92II CATG 2 cut(s) 55, 64
LguI GCTCTTC 1 cut(s) 62
LpnPI CCDG 1 cut(s) 93
MboII GAAGA 1 cut(s) 49
MnlI CCTC 1 cut(s) 115
Mph1103I ATGCAT 1 cut(s) 14
MslI CAYNNNNRTG 1 cut(s) 112
NlaIII CATG 2 cut(s) 55, 64
NsiI ATGCAT 1 cut(s) 14
NspI RCATGY 1 cut(s) 55
PciSI GCTCTTC 1 cut(s) 62
RsaI GTAC 1 cut(s) 70
RsaNI GTAC 1 cut(s) 69
RseI CAYNNNNRTG 1 cut(s) 112
SapI GCTCTTC 1 cut(s) 62
ScaI AGTACT 1 cut(s) 70
SetI ASST 1 cut(s) 126
SgeI CNNG 3 cut(s) 64, 73, 92
SmiMI CAYNNNNRTG 1 cut(s) 112
TatI WGTACW 1 cut(s) 68
TspDTI ATGAA 2 cut(s) 49, 99
XceI RCATGY 1 cut(s) 55
ZrmI AGTACT 1 cut(s) 70
Zsp2I ATGCAT 1 cut(s) 14
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.