RchiOBHm_Chr7g0200631

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Forward (+)
18373475 .. 18375412
1938 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ17959

Sequence Viewer

Length: 252 bp
ATGGCGTTTCCCAACACAAACCTCACGCTCTCTCTCTCTCTACCCTCTCCCTCGCCCTCTTCGACTTCTCTCCTGTCGACAACGTCTTCGACTACGGCTCCAACGTGGACTCCACCTTCGACGATGGCGGCCACTTCATTCTGGACTCGTCCATTTCAGATCGCTCAATTTCACTCTGAAACCAAAACCCCAATCCCGATTCCCCCCAAATTTACCAAACCGCTAGGGTTTTCCAGCGGTCATCCAGTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

83

Amino Acids

8.85

Weight (kDa)

10.29

Isoelectric Point (pI)

49.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 77
AciI CCGC 3 cut(s) 128, 221, 237
AcoI YGGCCR 1 cut(s) 129
AcsI RAATTY 1 cut(s) 209
AoxI GGCC 1 cut(s) 129
ApoI RAATTY 1 cut(s) 209
ArsI GACNNNNNNTTYG 4 cut(s) 70, 100, 102, 132
BbsI GAAGAC 1 cut(s) 78
BccI CCATC 1 cut(s) 118
BceAI ACGGC 1 cut(s) 111
BfaI CTAG 1 cut(s) 224
BisI GCNGC 1 cut(s) 129
BlsI GCNGC 1 cut(s) 130
BmiI GGNNCC 1 cut(s) 99
BpiI GAAGAC 1 cut(s) 78
BsaXI ACNNNNNCTCC 4 cut(s) 82, 94, 112, 124
Bse1I ACTGG 1 cut(s) 245
BseGI GGATG 1 cut(s) 241
BseNI ACTGG 1 cut(s) 245
BshFI GGCC 1 cut(s) 131
BsnI GGCC 1 cut(s) 131
Bsp143I GATC 1 cut(s) 159
BspACI CCGC 3 cut(s) 128, 221, 237
BspANI GGCC 1 cut(s) 131
BspLI GGNNCC 1 cut(s) 99
BsrI ACTGG 1 cut(s) 245
BssMI GATC 1 cut(s) 159
Bst6I CTCTTC 1 cut(s) 64
BstF5I GGATG 1 cut(s) 241
BstKTI GATC 1 cut(s) 162
BstMBI GATC 1 cut(s) 159
BstV2I GAAGAC 1 cut(s) 78
BsuRI GGCC 1 cut(s) 131
BtsCI GGATG 1 cut(s) 241
CviJI RGCY 2 cut(s) 98, 131
CviKI_1 RGCY 2 cut(s) 98, 131
DpnI GATC 1 cut(s) 161
DpnII GATC 1 cut(s) 159
EaeI YGGCCR 1 cut(s) 129
Eam1104I CTCTTC 1 cut(s) 64
EarI CTCTTC 1 cut(s) 64
FaiI YATR 1 cut(s) 250
FblI GTMKAC 1 cut(s) 77
Fnu4HI GCNGC 1 cut(s) 129
FokI GGATG 1 cut(s) 228
Fsp4HI GCNGC 1 cut(s) 129
FspBI CTAG 1 cut(s) 224
GluI GCNGC 1 cut(s) 129
HaeIII GGCC 1 cut(s) 131
HincII GTYRAC 1 cut(s) 78
HindII GTYRAC 1 cut(s) 78
HinfI GANTC 3 cut(s) 109, 145, 199
Hpy166II GTNNAC 2 cut(s) 78, 108
Hpy188I TCNGA 2 cut(s) 159, 178
Hpy188III TCNNGA 2 cut(s) 142, 196
Hpy8I GTNNAC 2 cut(s) 78, 108
Hpy99I CGWCG 1 cut(s) 124
HpyAV CCTTC 1 cut(s) 126
HpyCH4IV ACGT 2 cut(s) 83, 104
HpySE526I ACGT 2 cut(s) 83, 104
Kzo9I GATC 1 cut(s) 159
LmnI GCTCC 1 cut(s) 103
LpnPI CCDG 3 cut(s) 86, 127, 247
MaeI CTAG 1 cut(s) 224
MaeII ACGT 2 cut(s) 83, 104
MalI GATC 1 cut(s) 161
MboI GATC 1 cut(s) 159
MboII GAAGA 2 cut(s) 51, 78
MluCI AATT 2 cut(s) 167, 209
MlyI GAGTC 2 cut(s) 103, 139
MmeI TCCRAC 1 cut(s) 125
MnlI CCTC 4 cut(s) 32, 55, 61, 67
MspA1I CMGCKG 1 cut(s) 237
NdeII GATC 1 cut(s) 159
NlaIV GGNNCC 1 cut(s) 99
PcsI WCGNNNNNNNCGW 2 cut(s) 59, 101
PfeI GAWTC 1 cut(s) 199
PflFI GACNNNGTC 1 cut(s) 82
PkrI GCNGC 1 cut(s) 130
PleI GAGTC 2 cut(s) 103, 139
PpsI GAGTC 2 cut(s) 103, 139
PspN4I GGNNCC 1 cut(s) 99
PsyI GACNNNGTC 1 cut(s) 82
SalI GTCGAC 1 cut(s) 76
SatI GCNGC 1 cut(s) 129
Sau3AI GATC 1 cut(s) 159
SchI GAGTC 2 cut(s) 103, 139
SetI ASST 4 cut(s) 24, 86, 107, 118
SgeI CNNG 9 cut(s) 37, 64, 85, 117, 154, 159, 208, 236, 246
Sse9I AATT 2 cut(s) 167, 209
SsiI CCGC 3 cut(s) 128, 221, 237
SspMI CTAG 1 cut(s) 224
TaiI ACGT 2 cut(s) 86, 107
TaqI TCGA 4 cut(s) 62, 77, 89, 119
TasI AATT 2 cut(s) 167, 209
TauI GCSGC 1 cut(s) 131
TfiI GAWTC 1 cut(s) 199
TspDTI ATGAA 1 cut(s) 126
Tth111I GACNNNGTC 1 cut(s) 82
XapI RAATTY 1 cut(s) 209
XmiI GTMKAC 1 cut(s) 77
XspI CTAG 1 cut(s) 224
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.