Rorug04G0443500

Belongs to the cullin family

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
Physical Location & Seq
Forward (+)
59942451 .. 59944006
1556 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0443500.1

Sequence Viewer

Length: 435 bp
ATGGCCTCTCCTTCTATCTTTTTCATGTTATCTGCACTTTCCTTCACACATGGATCTGATCAATTTTATAACTGTCGTATTGTTTGGCTGTTAAAACCCTCTGCCAACCTCATCTCTCAGTCATATGCTTCTTCTTTCTTATCTAGCTCCTGCAGTTTGCTTCAACAAAGAATGAAACAAATAATAATAAGCCCAGAAACCTCTAAAGCTAAAGCATTAGAGAAGGTGGAGGATAAGTCCAAAGTTGCCAGGGCATTGAAGGAAAGTGTTCTCCATCAAATATGTGAGGCAAAGCCATTGGCTCTGATCATTGATTGGAATTCACTCCTGTCTAACAAAAAGAAGAGAACTGTGATCATAGCCCTGGCAAAGTTTGCACCAGAATCACAGGGCACACTGAATTTTAAGTTTGGAACTTCTTCTAGAGCTGTATAG

Protein Analysis

144

Amino Acids

15.96

Weight (kDa)

9.82

Isoelectric Point (pI)

47.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 69
AclWI GGATC 1 cut(s) 61
AcsI RAATTY 2 cut(s) 319, 400
AgsI TTSAA 2 cut(s) 164, 259
AjnI CCWGG 2 cut(s) 248, 363
AluBI AGCT 3 cut(s) 147, 209, 428
AluI AGCT 3 cut(s) 147, 209, 428
AlwI GGATC 1 cut(s) 61
AoxI GGCC 1 cut(s) 3
ApoI RAATTY 2 cut(s) 319, 400
Asp700I GAANNNNTTC 2 cut(s) 267, 418
BaeGI GKGCMC 1 cut(s) 395
BccI CCATC 1 cut(s) 282
BciT130I CCWGG 2 cut(s) 250, 365
BclI TGATCA 3 cut(s) 58, 306, 354
BfaI CTAG 2 cut(s) 144, 423
BfmI CTRYAG 1 cut(s) 151
Bme1390I CCNGG 2 cut(s) 250, 365
BmrFI CCNGG 2 cut(s) 250, 365
BsaJI CCNNGG 2 cut(s) 249, 363
BsaXI ACNNNNNCTCC 2 cut(s) 221, 251
BseBI CCWGG 2 cut(s) 250, 365
BseDI CCNNGG 2 cut(s) 249, 363
BseMII CTCAG 1 cut(s) 131
BseSI GKGCMC 1 cut(s) 395
BsgI GTGCAG 1 cut(s) 18
BshFI GGCC 1 cut(s) 5
BsnI GGCC 1 cut(s) 5
Bsp1286I GDGCHC 1 cut(s) 395
Bsp143I GATC 4 cut(s) 53, 58, 306, 354
BspANI GGCC 1 cut(s) 5
BspCNI CTCAG 1 cut(s) 130
BspMAI CTGCAG 1 cut(s) 155
BspPI GGATC 1 cut(s) 61
BssECI CCNNGG 2 cut(s) 249, 363
BssMI GATC 4 cut(s) 53, 58, 306, 354
Bst2UI CCWGG 2 cut(s) 250, 365
Bst4CI ACNGT 2 cut(s) 74, 352
Bst6I CTCTTC 1 cut(s) 338
BstAPI GCANNNNNTGC 1 cut(s) 374
BstDEI CTNAG 1 cut(s) 117
BstKTI GATC 4 cut(s) 56, 61, 309, 357
BstMBI GATC 4 cut(s) 53, 58, 306, 354
BstMWI GCNNNNNNNGC 1 cut(s) 374
BstNI CCWGG 2 cut(s) 250, 365
BstSCI CCNGG 2 cut(s) 248, 363
BstSFI CTRYAG 1 cut(s) 151
BstSLI GKGCMC 1 cut(s) 395
BstX2I RGATCY 1 cut(s) 53
BstYI RGATCY 1 cut(s) 53
BsuRI GGCC 1 cut(s) 5
BtsIMutI CAGTG 1 cut(s) 395
CviAII CATG 2 cut(s) 25, 50
CviJI RGCY 9 cut(s) 5, 88, 147, 192, 209, 295, 302, 362, 428
CviKI_1 RGCY 9 cut(s) 5, 88, 147, 192, 209, 295, 302, 362, 428
DdeI CTNAG 1 cut(s) 117
DpnI GATC 4 cut(s) 55, 60, 308, 356
DpnII GATC 4 cut(s) 53, 58, 306, 354
Eam1104I CTCTTC 1 cut(s) 338
EarI CTCTTC 1 cut(s) 338
EcoRI GAATTC 1 cut(s) 319
EcoRII CCWGG 2 cut(s) 248, 363
FaeI CATG 2 cut(s) 28, 53
FaiI YATR 8 cut(s) 26, 51, 69, 124, 126, 283, 359, 433
FatI CATG 2 cut(s) 24, 49
FauNDI CATATG 1 cut(s) 124
FbaI TGATCA 3 cut(s) 58, 306, 354
FspBI CTAG 2 cut(s) 144, 423
HaeIII GGCC 1 cut(s) 5
Hin1II CATG 2 cut(s) 28, 53
HinfI GANTC 1 cut(s) 383
Hpy188I TCNGA 2 cut(s) 58, 306
Hpy188III TCNNGA 1 cut(s) 423
HpyAV CCTTC 4 cut(s) 21, 52, 217, 253
HpyCH4III ACNGT 2 cut(s) 74, 352
HpyCH4V TGCA 3 cut(s) 35, 153, 377
HpyF10VI GCNNNNNNNGC 1 cut(s) 374
HpyF3I CTNAG 1 cut(s) 117
Hsp92II CATG 2 cut(s) 28, 53
Ksp22I TGATCA 3 cut(s) 58, 306, 354
Kzo9I GATC 4 cut(s) 53, 58, 306, 354
LmnI GCTCC 1 cut(s) 152
LpnPI CCDG 9 cut(s) 163, 207, 235, 262, 341, 350, 374, 377, 393
MaeI CTAG 2 cut(s) 144, 423
MalI GATC 4 cut(s) 55, 60, 308, 356
MboI GATC 4 cut(s) 53, 58, 306, 354
MboII GAAGA 3 cut(s) 123, 355, 411
MflI RGATCY 1 cut(s) 53
MhlI GDGCHC 1 cut(s) 395
MluCI AATT 3 cut(s) 62, 319, 400
MnlI CCTC 6 cut(s) 16, 109, 119, 211, 223, 280
MroXI GAANNNNTTC 2 cut(s) 267, 418
MseI TTAA 2 cut(s) 92, 405
MspR9I CCNGG 2 cut(s) 250, 365
MvaI CCWGG 2 cut(s) 250, 365
MwoI GCNNNNNNNGC 1 cut(s) 374
NdeI CATATG 1 cut(s) 124
NdeII GATC 4 cut(s) 53, 58, 306, 354
NlaIII CATG 2 cut(s) 28, 53
PdmI GAANNNNTTC 2 cut(s) 267, 418
PfeI GAWTC 1 cut(s) 383
PsiI TTATAA 1 cut(s) 69
Psp6I CCWGG 2 cut(s) 248, 363
PspGI CCWGG 2 cut(s) 248, 363
PstI CTGCAG 1 cut(s) 155
PsuI RGATCY 1 cut(s) 53
SaqAI TTAA 2 cut(s) 92, 405
Sau3AI GATC 4 cut(s) 53, 58, 306, 354
ScrFI CCNGG 2 cut(s) 250, 365
SduI GDGCHC 1 cut(s) 395
SetI ASST 6 cut(s) 111, 149, 203, 211, 228, 430
SfcI CTRYAG 1 cut(s) 151
Sse9I AATT 3 cut(s) 62, 319, 400
SspMI CTAG 2 cut(s) 144, 423
StyD4I CCNGG 2 cut(s) 248, 363
TaaI ACNGT 2 cut(s) 74, 352
TasI AATT 3 cut(s) 62, 319, 400
TfiI GAWTC 1 cut(s) 383
Tru1I TTAA 2 cut(s) 92, 405
Tru9I TTAA 2 cut(s) 92, 405
TscAI CASTG 1 cut(s) 402
TspDTI ATGAA 2 cut(s) 13, 188
TspRI CASTG 1 cut(s) 402
XapI RAATTY 2 cut(s) 319, 400
XbaI TCTAGA 1 cut(s) 422
XmnI GAANNNNTTC 2 cut(s) 267, 418
XspI CTAG 2 cut(s) 144, 423
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.