Rorug04G0030200

Belongs to the cullin family

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
Physical Location & Seq
Forward (+)
4200126 .. 4200401
276 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0030200.1

Sequence Viewer

Length: 276 bp
ATGGAAAATGCATTGGGTGCAACAGATGTTAATGTCGAGAATTTTGATTTGGAATTGGATTGGAAACCTAGAAAAGGAATGAAGTTTGATTCTGAACAAGCAACTTATGACTTCTACAATAGATATGGAGGAAAAAAGGGGGTTAGTATTCAAAGGGAGAATCATGCTAAGAATAAGAAAACTGGTGAAATCACTTTAAGAGTATTTGTTTGCTATAAGGAAGGTAATCGATCCAAAGATAAGAGGGATTACATGACTAGAAAACCCAGACCCTAA

Protein Analysis

91

Amino Acids

10.71

Weight (kDa)

9.52

Isoelectric Point (pI)

33.45

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
FAR1 PF03101 37 - 90 2.9e-09 FAR1 DNA-binding domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 225
AcsI RAATTY 1 cut(s) 40
AfiI CCNNNNNNNGG 1 cut(s) 74
AgsI TTSAA 1 cut(s) 152
AjuI GAANNNNNNNTTGG 2 cut(s) 32, 64
AlwI GGATC 1 cut(s) 225
ApoI RAATTY 1 cut(s) 40
AsuHPI GGTGA 1 cut(s) 197
BfaI CTAG 2 cut(s) 69, 258
Bsa29I ATCGAT 1 cut(s) 229
Bsc4I CCNNNNNNNGG 1 cut(s) 74
Bse1I ACTGG 1 cut(s) 187
BseCI ATCGAT 1 cut(s) 229
BseLI CCNNNNNNNGG 1 cut(s) 74
BseNI ACTGG 1 cut(s) 187
BshVI ATCGAT 1 cut(s) 229
BslI CCNNNNNNNGG 1 cut(s) 74
Bsp143I GATC 1 cut(s) 230
BspDI ATCGAT 1 cut(s) 229
BspPI GGATC 1 cut(s) 225
BsrI ACTGG 1 cut(s) 187
BssMI GATC 1 cut(s) 230
BstAPI GCANNNNNTGC 1 cut(s) 17
BstDEI CTNAG 1 cut(s) 168
BstENI CCTNNNNNAGG 1 cut(s) 72
BstKTI GATC 1 cut(s) 233
BstMBI GATC 1 cut(s) 230
BstMWI GCNNNNNNNGC 1 cut(s) 17
Bsu15I ATCGAT 1 cut(s) 229
BsuTUI ATCGAT 1 cut(s) 229
ClaI ATCGAT 1 cut(s) 229
CviAII CATG 2 cut(s) 164, 253
DdeI CTNAG 1 cut(s) 168
DpnI GATC 1 cut(s) 232
DpnII GATC 1 cut(s) 230
EcoNI CCTNNNNNAGG 1 cut(s) 72
EcoT22I ATGCAT 1 cut(s) 13
FaeI CATG 2 cut(s) 167, 256
FaiI YATR 5 cut(s) 108, 126, 165, 216, 254
FatI CATG 2 cut(s) 163, 252
FspBI CTAG 2 cut(s) 69, 258
Hin1II CATG 2 cut(s) 167, 256
HinfI GANTC 2 cut(s) 89, 160
HphI GGTGA 1 cut(s) 197
Hpy188I TCNGA 1 cut(s) 94
Hpy188III TCNNGA 1 cut(s) 37
HpyAV CCTTC 1 cut(s) 215
HpyCH4V TGCA 2 cut(s) 11, 20
HpyF10VI GCNNNNNNNGC 1 cut(s) 17
HpyF3I CTNAG 1 cut(s) 168
Hsp92II CATG 2 cut(s) 167, 256
Kzo9I GATC 1 cut(s) 230
LpnPI CCDG 1 cut(s) 168
MaeI CTAG 2 cut(s) 69, 258
MalI GATC 1 cut(s) 232
MboI GATC 1 cut(s) 230
MluCI AATT 2 cut(s) 40, 53
MnlI CCTC 2 cut(s) 122, 237
Mph1103I ATGCAT 1 cut(s) 13
MseI TTAA 2 cut(s) 30, 197
MwoI GCNNNNNNNGC 1 cut(s) 17
NdeII GATC 1 cut(s) 230
NlaIII CATG 2 cut(s) 167, 256
NsiI ATGCAT 1 cut(s) 13
PfeI GAWTC 2 cut(s) 89, 160
SaqAI TTAA 2 cut(s) 30, 197
Sau3AI GATC 1 cut(s) 230
SetI ASST 2 cut(s) 70, 226
SgeI CNNG 7 cut(s) 49, 81, 110, 176, 195, 265, 270
Sse9I AATT 2 cut(s) 40, 53
SspMI CTAG 2 cut(s) 69, 258
TaqI TCGA 2 cut(s) 36, 229
TasI AATT 2 cut(s) 40, 53
TfiI GAWTC 2 cut(s) 89, 160
Tru1I TTAA 2 cut(s) 30, 197
Tru9I TTAA 2 cut(s) 30, 197
TspDTI ATGAA 1 cut(s) 95
XagI CCTNNNNNAGG 1 cut(s) 72
XapI RAATTY 1 cut(s) 40
XspI CTAG 2 cut(s) 69, 258
Zsp2I ATGCAT 1 cut(s) 13
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.