Rh7CG205400

Belongs to the cullin family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
Physical Location & Seq
Forward (+)
18320408 .. 18326167
5760 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG205400.1

Sequence Viewer

Length: 186 bp
ATGGGTGGACTATTTCGGTATGAGCTTGAGGAAGTATGGTTGGGCTTTAGGCTAAGCAGTCTCATTGATTCGAAGTTTGACATATCTTCTTGGATTCCTGAGGCTCAAGAGAGATTTAATGAAATCAAGACCCCTCGTAAGCTATTGTGGAAGAAGAATCTTGGTACTGTCAAGTTTATTAACTAA

Protein Analysis

61

Amino Acids

7.28

Weight (kDa)

9.22

Isoelectric Point (pI)

34.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 166
AluBI AGCT 2 cut(s) 25, 142
AluI AGCT 2 cut(s) 25, 142
Alw26I GTCTC 1 cut(s) 65
AsuII TTCGAA 1 cut(s) 71
AxyI CCTNAGG 1 cut(s) 99
BcoDI GTCTC 1 cut(s) 65
BlpI GCTNAGC 1 cut(s) 53
Bpu1102I GCTNAGC 1 cut(s) 53
Bpu14I TTCGAA 1 cut(s) 71
BpuEI CTTGAG 2 cut(s) 47, 90
Bse21I CCTNAGG 1 cut(s) 99
BseMII CTCAG 1 cut(s) 90
BsmAI GTCTC 1 cut(s) 65
Bsp119I TTCGAA 1 cut(s) 71
Bsp1720I GCTNAGC 1 cut(s) 53
BspCNI CTCAG 1 cut(s) 91
BspT104I TTCGAA 1 cut(s) 71
Bst4CI ACNGT 1 cut(s) 169
BstBI TTCGAA 1 cut(s) 71
BstDEI CTNAG 2 cut(s) 53, 99
BstMAI GTCTC 1 cut(s) 65
Bsu36I CCTNAGG 1 cut(s) 99
Csp6I GTAC 1 cut(s) 165
CviJI RGCY 5 cut(s) 25, 45, 52, 104, 142
CviKI_1 RGCY 5 cut(s) 25, 45, 52, 104, 142
CviQI GTAC 1 cut(s) 165
DdeI CTNAG 2 cut(s) 53, 99
Eco81I CCTNAGG 1 cut(s) 99
FaiI YATR 3 cut(s) 21, 37, 83
HinfI GANTC 3 cut(s) 68, 94, 157
Hpy166II GTNNAC 1 cut(s) 8
Hpy188III TCNNGA 3 cut(s) 98, 107, 127
Hpy8I GTNNAC 1 cut(s) 8
HpyCH4III ACNGT 1 cut(s) 169
HpyF3I CTNAG 2 cut(s) 53, 99
LpnPI CCDG 1 cut(s) 111
MboII GAAGA 3 cut(s) 78, 163, 166
MnlI CCTC 3 cut(s) 22, 94, 144
MseI TTAA 2 cut(s) 117, 180
NspV TTCGAA 1 cut(s) 71
PfeI GAWTC 3 cut(s) 68, 94, 157
RsaI GTAC 1 cut(s) 166
RsaNI GTAC 1 cut(s) 165
SaqAI TTAA 2 cut(s) 117, 180
SetI ASST 2 cut(s) 27, 144
SfuI TTCGAA 1 cut(s) 71
SgeI CNNG 7 cut(s) 38, 102, 110, 119, 139, 147, 173
SmlI CTYRAG 2 cut(s) 26, 105
SmoI CTYRAG 2 cut(s) 26, 105
TaaI ACNGT 1 cut(s) 169
TaqI TCGA 1 cut(s) 71
TfiI GAWTC 3 cut(s) 68, 94, 157
Tru1I TTAA 2 cut(s) 117, 180
Tru9I TTAA 2 cut(s) 117, 180
TspDTI ATGAA 1 cut(s) 135
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.