Rmu_sc0006782.1_g000010

Belongs to the peptidase S10 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006782.1
OG0000801
Physical Location & Seq
Reverse (-)
28536 .. 30877
2342 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006782.1_g000010.1.cds

Sequence Viewer

Length: 576 bp
atggagcgaagtaatctaagtagaggcgtgcagcggatgcggggcagcaggggctgcagtggtgatggcagtgcacgggcacgcaagcaggcagctgcggacgcaggggcgcgcaggcagggcaggtgcagggctgcagacgtgcgggcgtgtggacaagcagtagcgtgcgcaggggcgcggggctgcagggcagcgacgcaggggcgtgtggctgtaggtgcagcgcgcagggcagcaggggctgctgcgatgtgtggtgatgttgatatggctattccatatgtgggtacttttgcttggatagaatctctgaacttgactattgatgatgagatttcatggaaaccttggttcgtcaatgcacaagttgcaggggttcttgttcttgctcccaagttgccttcccaccatccaagtgcagtgaacgtgagctttgaatgccgtaagatcaactggcttgcgggtcagaggttttccaatcagaaaggattgggaggaccaccgccaatcttcctaggtcaggagcgccgcctctttcagcgagtgcaagggaagcagcgaatcttgaggtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Peptidase_S10

Protein Analysis

191

Amino Acids

20.44

Weight (kDa)

11.22

Isoelectric Point (pI)

38.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 114
Acc16I TGCGCA 1 cut(s) 172
Acc36I ACCTGC 1 cut(s) 114
AccII CGCG 3 cut(s) 112, 181, 229
AciI CCGC 8 cut(s) 34, 40, 98, 145, 181, 464, 506, 532
AfaI GTAC 1 cut(s) 292
AfiI CCNNNNNNNGG 2 cut(s) 287, 523
AgsI TTSAA 1 cut(s) 440
AjiI CACGTC 1 cut(s) 142
AluBI AGCT 2 cut(s) 95, 435
AluI AGCT 2 cut(s) 95, 435
Alw21I GWGCWC 1 cut(s) 76
Alw44I GTGCAC 1 cut(s) 72
AlwNI CAGNNNCTG 2 cut(s) 54, 245
ApaLI GTGCAC 1 cut(s) 72
AspA2I CCTAGG 1 cut(s) 517
AspLEI GCGC 7 cut(s) 112, 114, 173, 181, 229, 231, 531
AspS9I GGNCC 1 cut(s) 500
AsuHPI GGTGA 2 cut(s) 74, 272
AvaII GGWCC 1 cut(s) 500
AvrII CCTAGG 1 cut(s) 517
BaeGI GKGCMC 2 cut(s) 76, 82
Bbv12I GWGCWC 1 cut(s) 76
BccI CCATC 2 cut(s) 59, 420
BceAI ACGGC 1 cut(s) 429
BfaI CTAG 1 cut(s) 518
BfmI CTRYAG 4 cut(s) 55, 135, 187, 216
BfoI RGCGCY 1 cut(s) 532
BfuAI ACCTGC 1 cut(s) 114
BlnI CCTAGG 1 cut(s) 517
Bme18I GGWCC 1 cut(s) 500
BmgBI CACGTC 1 cut(s) 142
BmgT120I GGNCC 1 cut(s) 500
BmsI GCATC 1 cut(s) 27
BsaJI CCNNGG 2 cut(s) 350, 517
Bsc4I CCNNNNNNNGG 2 cut(s) 287, 523
Bse1I ACTGG 1 cut(s) 461
BseDI CCNNGG 2 cut(s) 350, 517
BseGI GGATG 2 cut(s) 42, 412
BseLI CCNNNNNNNGG 2 cut(s) 287, 523
BseNI ACTGG 1 cut(s) 461
BsePI GCGCGC 2 cut(s) 110, 227
BseSI GKGCMC 2 cut(s) 76, 82
BsgI GTGCAG 4 cut(s) 50, 148, 243, 441
Bsh1236I CGCG 3 cut(s) 112, 181, 229
BsiHKAI GWGCWC 1 cut(s) 76
BslI CCNNNNNNNGG 2 cut(s) 287, 523
BsmI GAATGC 1 cut(s) 446
Bsp1286I GDGCHC 2 cut(s) 76, 82
Bsp143I GATC 1 cut(s) 450
BspACI CCGC 8 cut(s) 34, 40, 98, 145, 181, 464, 506, 532
BspFNI CGCG 3 cut(s) 112, 181, 229
BspMAI CTGCAG 3 cut(s) 59, 139, 191
BspMI ACCTGC 1 cut(s) 114
BsrI ACTGG 1 cut(s) 461
BssECI CCNNGG 2 cut(s) 350, 517
BssHII GCGCGC 2 cut(s) 110, 227
BssMI GATC 1 cut(s) 450
BssT1I CCWWGG 2 cut(s) 350, 517
BstAPI GCANNNNNTGC 4 cut(s) 37, 54, 245, 371
BstDEI CTNAG 1 cut(s) 17
BstENI CCTNNNNNAGG 1 cut(s) 521
BstF5I GGATG 2 cut(s) 42, 412
BstFNI CGCG 3 cut(s) 112, 181, 229
BstH2I RGCGCY 1 cut(s) 532
BstHHI GCGC 7 cut(s) 112, 114, 173, 181, 229, 231, 531
BstKTI GATC 1 cut(s) 453
BstMBI GATC 1 cut(s) 450
BstSFI CTRYAG 4 cut(s) 55, 135, 187, 216
BstSLI GKGCMC 2 cut(s) 76, 82
BstUI CGCG 3 cut(s) 112, 181, 229
BtgZI GCGATG 1 cut(s) 266
BtrI CACGTC 1 cut(s) 142
BtsCI GGATG 2 cut(s) 42, 412
BtsI GCAGTG 3 cut(s) 64, 76, 429
BtsIMutI CAGTG 3 cut(s) 64, 76, 429
BveI ACCTGC 1 cut(s) 114
CaiI CAGNNNCTG 2 cut(s) 54, 245
CfoI GCGC 7 cut(s) 112, 114, 173, 181, 229, 231, 531
Cfr13I GGNCC 1 cut(s) 500
CseI GACGC 2 cut(s) 110, 208
Csp6I GTAC 1 cut(s) 291
CviAII CATG 1 cut(s) 342
CviJI RGCY 9 cut(s) 54, 95, 134, 186, 215, 245, 275, 435, 460
CviKI_1 RGCY 9 cut(s) 54, 95, 134, 186, 215, 245, 275, 435, 460
CviQI GTAC 1 cut(s) 291
DdeI CTNAG 1 cut(s) 17
DpnI GATC 1 cut(s) 452
DpnII GATC 1 cut(s) 450
Eco130I CCWWGG 2 cut(s) 350, 517
Eco47I GGWCC 1 cut(s) 500
EcoNI CCTNNNNNAGG 1 cut(s) 521
EcoT14I CCWWGG 2 cut(s) 350, 517
ErhI CCWWGG 2 cut(s) 350, 517
FaeI CATG 1 cut(s) 345
FaiI YATR 4 cut(s) 272, 283, 285, 343
FatI CATG 1 cut(s) 341
FauI CCCGC 4 cut(s) 33, 138, 174, 457
FauNDI CATATG 1 cut(s) 283
FokI GGATG 2 cut(s) 49, 399
FspBI CTAG 1 cut(s) 518
FspI TGCGCA 1 cut(s) 172
GlaI GCGC 7 cut(s) 111, 113, 172, 180, 228, 230, 530
HaeII RGCGCY 1 cut(s) 532
HgaI GACGC 2 cut(s) 110, 208
HhaI GCGC 7 cut(s) 112, 114, 173, 181, 229, 231, 531
Hin1II CATG 1 cut(s) 345
Hin6I GCGC 7 cut(s) 110, 112, 171, 179, 227, 229, 529
HinP1I GCGC 7 cut(s) 110, 112, 171, 179, 227, 229, 529
HinfI GANTC 2 cut(s) 308, 564
HphI GGTGA 2 cut(s) 74, 272
Hpy166II GTNNAC 3 cut(s) 74, 155, 427
Hpy188I TCNGA 3 cut(s) 315, 471, 486
Hpy188III TCNNGA 2 cut(s) 524, 568
Hpy8I GTNNAC 3 cut(s) 74, 155, 427
Hpy99I CGWCG 1 cut(s) 202
HpyAV CCTTC 1 cut(s) 414
HpyCH4IV ACGT 2 cut(s) 141, 429
HpyF3I CTNAG 1 cut(s) 17
HpySE526I ACGT 2 cut(s) 141, 429
Hsp92II CATG 1 cut(s) 345
HspAI GCGC 7 cut(s) 110, 112, 171, 179, 227, 229, 529
Kzo9I GATC 1 cut(s) 450
LmnI GCTCC 3 cut(s) 4, 397, 526
LweI GCATC 1 cut(s) 27
MaeI CTAG 1 cut(s) 518
MaeII ACGT 2 cut(s) 141, 429
MalI GATC 1 cut(s) 452
MboI GATC 1 cut(s) 450
MboII GAAGA 1 cut(s) 505
MhlI GDGCHC 2 cut(s) 76, 82
MnlI CCTC 5 cut(s) 17, 465, 491, 545, 564
MslI CAYNNNNRTG 1 cut(s) 417
MspA1I CMGCKG 2 cut(s) 34, 95
Mva1269I GAATGC 1 cut(s) 446
MvnI CGCG 3 cut(s) 112, 181, 229
NdeI CATATG 1 cut(s) 283
NdeII GATC 1 cut(s) 450
NlaIII CATG 1 cut(s) 345
NsbI TGCGCA 1 cut(s) 172
PaqCI CACCTGC 1 cut(s) 114
PauI GCGCGC 2 cut(s) 110, 227
PctI GAATGC 1 cut(s) 446
PfeI GAWTC 2 cut(s) 308, 564
PspPI GGNCC 1 cut(s) 500
PstI CTGCAG 3 cut(s) 59, 139, 191
PstNI CAGNNNCTG 2 cut(s) 54, 245
PteI GCGCGC 2 cut(s) 110, 227
PvuII CAGCTG 1 cut(s) 95
RsaI GTAC 1 cut(s) 292
RsaNI GTAC 1 cut(s) 291
RseI CAYNNNNRTG 1 cut(s) 417
Sau3AI GATC 1 cut(s) 450
Sau96I GGNCC 1 cut(s) 500
SduI GDGCHC 2 cut(s) 76, 82
SfaNI GCATC 1 cut(s) 27
SfcI CTRYAG 4 cut(s) 55, 135, 187, 216
SinI GGWCC 1 cut(s) 500
SmiMI CAYNNNNRTG 1 cut(s) 417
SmlI CTYRAG 1 cut(s) 568
SmoI CTYRAG 1 cut(s) 568
SsiI CCGC 8 cut(s) 34, 40, 98, 145, 181, 464, 506, 532
SspMI CTAG 1 cut(s) 518
StyI CCWWGG 2 cut(s) 350, 517
TaiI ACGT 2 cut(s) 144, 432
TauI GCSGC 1 cut(s) 534
TfiI GAWTC 2 cut(s) 308, 564
TscAI CASTG 3 cut(s) 64, 76, 429
TspDTI ATGAA 1 cut(s) 330
TspRI CASTG 3 cut(s) 64, 76, 429
VneI GTGCAC 1 cut(s) 72
VpaK11BI GGWCC 1 cut(s) 500
XagI CCTNNNNNAGG 1 cut(s) 521
XmaJI CCTAGG 1 cut(s) 517
XspI CTAG 1 cut(s) 518
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.