Rroxscaffold_4G00283810

f-box protein

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Forward (+)
5637792 .. 5643334
5543 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00283810.1

Sequence Viewer

Length: 150 bp
ATGGTATTTGTTGCAGATTTTGCTTTCAAAGTTCGAGCTAAACTTGAAGCGGCTTTGAGGTTGAACTCAGTTCATCACTATGTGATGAAAAGGCCGTGGCTTGGTCTGTATGTGAGTAGGAATACTTATAGTGGCACTGGAGTTGCATAA

Protein Analysis

49

Amino Acids

5.57

Weight (kDa)

10.28

Isoelectric Point (pI)

26.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 50
AdeI CACNNNGTG 1 cut(s) 82
AfiI CCNNNNNNNGG 1 cut(s) 101
AgsI TTSAA 3 cut(s) 28, 47, 64
AluBI AGCT 1 cut(s) 38
AluI AGCT 1 cut(s) 38
AoxI GGCC 1 cut(s) 92
BceAI ACGGC 1 cut(s) 79
BisI GCNGC 1 cut(s) 51
BlsI GCNGC 1 cut(s) 52
BsaJI CCNNGG 1 cut(s) 95
Bsc4I CCNNNNNNNGG 1 cut(s) 101
Bse1I ACTGG 1 cut(s) 142
BseDI CCNNGG 1 cut(s) 95
BseLI CCNNNNNNNGG 1 cut(s) 101
BseMII CTCAG 1 cut(s) 81
BseNI ACTGG 1 cut(s) 142
BshFI GGCC 1 cut(s) 94
BslI CCNNNNNNNGG 1 cut(s) 101
BsnI GGCC 1 cut(s) 94
BspACI CCGC 1 cut(s) 50
BspANI GGCC 1 cut(s) 94
BspCNI CTCAG 1 cut(s) 80
BsrI ACTGG 1 cut(s) 142
BssECI CCNNGG 1 cut(s) 95
BstAPI GCANNNNNTGC 1 cut(s) 20
BstDEI CTNAG 1 cut(s) 67
BstDSI CCRYGG 1 cut(s) 95
BstMWI GCNNNNNNNGC 1 cut(s) 20
BsuRI GGCC 1 cut(s) 94
BtgI CCRYGG 1 cut(s) 95
BtsIMutI CAGTG 1 cut(s) 135
CviJI RGCY 4 cut(s) 38, 53, 94, 100
CviKI_1 RGCY 4 cut(s) 38, 53, 94, 100
DdeI CTNAG 1 cut(s) 67
DraIII CACNNNGTG 1 cut(s) 82
FaiI YATR 4 cut(s) 81, 111, 129, 148
Fnu4HI GCNGC 1 cut(s) 51
Fsp4HI GCNGC 1 cut(s) 51
FspEI CC 9 cut(s) 35, 43, 76, 82, 87, 103, 108, 117, 123
GluI GCNGC 1 cut(s) 51
HaeIII GGCC 1 cut(s) 94
HpyCH4V TGCA 2 cut(s) 14, 146
HpyF10VI GCNNNNNNNGC 1 cut(s) 20
HpyF3I CTNAG 1 cut(s) 67
LpnPI CCDG 1 cut(s) 123
MnlI CCTC 1 cut(s) 51
MslI CAYNNNNRTG 1 cut(s) 78
MwoI GCNNNNNNNGC 1 cut(s) 20
PkrI GCNGC 1 cut(s) 52
RseI CAYNNNNRTG 1 cut(s) 78
SatI GCNGC 1 cut(s) 51
SetI ASST 2 cut(s) 40, 62
SgeI CNNG 4 cut(s) 47, 56, 108, 113
SmiMI CAYNNNNRTG 1 cut(s) 78
SsiI CCGC 1 cut(s) 50
TaqI TCGA 1 cut(s) 34
TauI GCSGC 1 cut(s) 53
TscAI CASTG 1 cut(s) 142
TspDTI ATGAA 2 cut(s) 62, 101
TspRI CASTG 1 cut(s) 142
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.