Rh5BG490100

Belongs to the eukaryotic ribosomal protein eS1 family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
Physical Location & Seq
Reverse (-)
78017335 .. 78018106
772 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG490100.1

Sequence Viewer

Length: 216 bp
ATGTCACTGAGATGTCGTGACGTTGAGCAGTGGATAAGCCATAGACGTTTGCCAGATGAACTAGGGAGGTTATTCCACAAGCAATATGCACTAGATATGGACTTGCTATGGGTTCCAACCAATATGATTGCTTCAGAAGGACTGAAGCACAGAGTCTTTGAGACATCACTGGCTGACCTTCAGGGAGATGAGGAGCATGCTTACAGTACCTATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

71

Amino Acids

8.42

Weight (kDa)

5.41

Isoelectric Point (pI)

51.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 3 cut(s) 117, 164, 164
AfaI GTAC 1 cut(s) 208
Alw26I GTCTC 1 cut(s) 155
BcoDI GTCTC 1 cut(s) 155
BfaI CTAG 2 cut(s) 62, 92
BmiI GGNNCC 1 cut(s) 114
Bse1I ACTGG 1 cut(s) 174
BseNI ACTGG 1 cut(s) 174
BseRI GAGGAG 1 cut(s) 206
BsmAI GTCTC 1 cut(s) 155
BspLI GGNNCC 1 cut(s) 114
BsrI ACTGG 1 cut(s) 174
Bst4CI ACNGT 1 cut(s) 206
BstC8I GCNNGC 1 cut(s) 198
BstDEI CTNAG 1 cut(s) 8
BstMAI GTCTC 1 cut(s) 155
BstNSI RCATGY 1 cut(s) 200
BtsI GCAGTG 1 cut(s) 35
BtsIMutI CAGTG 3 cut(s) 5, 35, 167
Cac8I GCNNGC 1 cut(s) 198
Csp6I GTAC 1 cut(s) 207
CviAII CATG 1 cut(s) 197
CviJI RGCY 2 cut(s) 39, 173
CviKI_1 RGCY 2 cut(s) 39, 173
CviQI GTAC 1 cut(s) 207
DdeI CTNAG 1 cut(s) 8
Eco57I CTGAAG 3 cut(s) 117, 164, 164
FaeI CATG 1 cut(s) 200
FaiI YATR 6 cut(s) 42, 87, 98, 109, 125, 198
FatI CATG 1 cut(s) 196
FspBI CTAG 2 cut(s) 62, 92
Hin1II CATG 1 cut(s) 200
HinfI GANTC 1 cut(s) 153
Hpy188I TCNGA 1 cut(s) 136
Hpy188III TCNNGA 1 cut(s) 17
HpyAV CCTTC 2 cut(s) 131, 188
HpyCH4III ACNGT 1 cut(s) 206
HpyCH4IV ACGT 2 cut(s) 21, 46
HpyCH4V TGCA 1 cut(s) 89
HpyF3I CTNAG 1 cut(s) 8
HpySE526I ACGT 2 cut(s) 21, 46
Hsp92II CATG 1 cut(s) 200
LmnI GCTCC 1 cut(s) 193
LpnPI CCDG 3 cut(s) 66, 155, 167
MaeI CTAG 2 cut(s) 62, 92
MaeII ACGT 2 cut(s) 21, 46
MaeIII GTNAC 2 cut(s) 3, 17
MlyI GAGTC 1 cut(s) 162
MmeI TCCRAC 1 cut(s) 140
MnlI CCTC 2 cut(s) 60, 184
MseI TTAA 1 cut(s) 214
MslI CAYNNNNRTG 1 cut(s) 10
NlaIII CATG 1 cut(s) 200
NlaIV GGNNCC 1 cut(s) 114
NmuCI GTSAC 2 cut(s) 3, 17
NspI RCATGY 1 cut(s) 200
PaeI GCATGC 1 cut(s) 200
PleI GAGTC 1 cut(s) 161
PpsI GAGTC 1 cut(s) 161
PspN4I GGNNCC 1 cut(s) 114
RsaI GTAC 1 cut(s) 208
RsaNI GTAC 1 cut(s) 207
RseI CAYNNNNRTG 1 cut(s) 10
SaqAI TTAA 1 cut(s) 214
SchI GAGTC 1 cut(s) 162
SetI ASST 5 cut(s) 24, 49, 71, 180, 212
SgeI CNNG 9 cut(s) 29, 65, 74, 91, 104, 115, 182, 194, 209
SmiMI CAYNNNNRTG 1 cut(s) 10
SphI GCATGC 1 cut(s) 200
SspMI CTAG 2 cut(s) 62, 92
TaaI ACNGT 1 cut(s) 206
TaiI ACGT 2 cut(s) 24, 49
Tru1I TTAA 1 cut(s) 214
Tru9I TTAA 1 cut(s) 214
TscAI CASTG 3 cut(s) 12, 35, 174
TseFI GTSAC 2 cut(s) 3, 17
Tsp45I GTSAC 2 cut(s) 3, 17
TspDTI ATGAA 1 cut(s) 72
TspRI CASTG 3 cut(s) 12, 35, 174
XceI RCATGY 1 cut(s) 200
XspI CTAG 2 cut(s) 62, 92
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.