RLG00000001047

ubiquitin-protein transferase activity

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr1
OG0000735
Physical Location & Seq
Reverse (-)
9775845 .. 9776665
821 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000001047

Sequence Viewer

Length: 639 bp
ATGGATCAGGAAATTGAGAATACTAGCACTGATTGCTGGTTGGAAAAGATCGAAGATCCTGAAATCGAGTTGGGTTGCACCAAGTTGGTGATGGAGATCGAGGCCACAATTACATGCCCCGGCAGATATTCGGAGGAAGAAGAAGATGATGAGGACTACTCCGATATCAATCAAATTCTAGCACAAGACAGCAACAGTTATGAGGACACACTCGAACTTAACTTCTTGATGGACGACAACAATGGAACCGCCCCGACTCGATTTATGAAGGAACAAATATCTAGCAAGCTCTTCGACTTGAATGTTCCCTTTAGGGATCATGAATCCATAGCAGACAAAATATTGAACGATATCTTTGCGGTGGCAAGAGATCCTAGTCGTAAAGCCGACGGCAAGATTTTGTGTATGAGGGCTGTCATCCATGCTTTTGGGGAAGAATTGGAAGATGAGGATATGGACATTGACCCTAAATTTGTGCCTGCAAGTAAATCGGCTTTGGAGAAGTTGGAGAGGGCGATCGTTGTCCAAGTCTCAACAGTGTGTTCGTTGATGATTGTTGACCATCTATTCAACGATATTATCCATTTTGTTTTTGAGAAGAATGATATTATCCATTTGATAGACAAAATTAGACTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
F-box FBA_3 zf-RING_2

Protein Analysis

213

Amino Acids

24.31

Weight (kDa)

4.27

Isoelectric Point (pI)

44.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 249, 359
AclWI GGATC 4 cut(s) 12, 50, 324, 365
AcsI RAATTY 2 cut(s) 174, 470
AgsI TTSAA 3 cut(s) 301, 346, 571
AluBI AGCT 1 cut(s) 289
AluI AGCT 1 cut(s) 289
Alw26I GTCTC 1 cut(s) 535
AlwI GGATC 4 cut(s) 12, 50, 324, 365
AoxI GGCC 1 cut(s) 102
ApoI RAATTY 2 cut(s) 174, 470
ArsI GACNNNNNNTTYG 2 cut(s) 455, 487
AsuC2I CCSGG 1 cut(s) 120
AsuHPI GGTGA 1 cut(s) 100
BccI CCATC 3 cut(s) 85, 223, 570
BceAI ACGGC 1 cut(s) 406
BcgI CGANNNNNNTGC 6 cut(s) 274, 308, 338, 372, 471, 505
BcnI CCSGG 1 cut(s) 120
BcoDI GTCTC 1 cut(s) 535
BfaI CTAG 4 cut(s) 24, 179, 282, 375
Bme1390I CCNGG 1 cut(s) 120
BmiI GGNNCC 1 cut(s) 247
BmrFI CCNGG 1 cut(s) 120
BplI GAGNNNNNCTC 2 cut(s) 143, 175
BpuMI CCSGG 1 cut(s) 120
BsaBI GATNNNNATC 2 cut(s) 95, 168
BsaJI CCNNGG 1 cut(s) 118
Bse8I GATNNNNATC 2 cut(s) 95, 168
BseDI CCNNGG 1 cut(s) 118
BseGI GGATG 1 cut(s) 417
BseJI GATNNNNATC 2 cut(s) 95, 168
Bsh1285I CGRYCG 1 cut(s) 519
BshFI GGCC 1 cut(s) 104
BsiEI CGRYCG 1 cut(s) 519
BsiSI CCGG 1 cut(s) 120
BsmAI GTCTC 1 cut(s) 535
BsnI GGCC 1 cut(s) 104
Bsp143I GATC 7 cut(s) 4, 48, 55, 96, 316, 370, 516
BspACI CCGC 2 cut(s) 249, 359
BspANI GGCC 1 cut(s) 104
BspHI TCATGA 1 cut(s) 319
BspLI GGNNCC 1 cut(s) 247
BspPI GGATC 4 cut(s) 12, 50, 324, 365
BspQI GCTCTTC 1 cut(s) 296
BssECI CCNNGG 1 cut(s) 118
BssMI GATC 7 cut(s) 4, 48, 55, 96, 316, 370, 516
Bst4CI ACNGT 2 cut(s) 197, 538
Bst6I CTCTTC 1 cut(s) 296
BstAPI GCANNNNNTGC 1 cut(s) 33
BstC8I GCNNGC 2 cut(s) 287, 480
BstF5I GGATG 1 cut(s) 417
BstKTI GATC 7 cut(s) 7, 51, 58, 99, 319, 373, 519
BstMAI GTCTC 1 cut(s) 535
BstMBI GATC 7 cut(s) 4, 48, 55, 96, 316, 370, 516
BstMCI CGRYCG 1 cut(s) 519
BstMWI GCNNNNNNNGC 1 cut(s) 33
BstNSI RCATGY 1 cut(s) 117
BstSCI CCNGG 1 cut(s) 118
BstX2I RGATCY 2 cut(s) 55, 370
BstXI CCANNNNNNTGG 1 cut(s) 428
BstYI RGATCY 2 cut(s) 55, 370
BsuRI GGCC 1 cut(s) 104
BtsCI GGATG 1 cut(s) 417
BtsIMutI CAGTG 2 cut(s) 27, 543
Cac8I GCNNGC 2 cut(s) 287, 480
CciI TCATGA 1 cut(s) 319
CviAII CATG 3 cut(s) 114, 320, 422
CviJI RGCY 5 cut(s) 104, 289, 386, 413, 494
CviKI_1 RGCY 5 cut(s) 104, 289, 386, 413, 494
DpnI GATC 7 cut(s) 6, 50, 57, 98, 318, 372, 518
DpnII GATC 7 cut(s) 4, 48, 55, 96, 316, 370, 516
Eam1104I CTCTTC 1 cut(s) 296
EarI CTCTTC 1 cut(s) 296
Eco32I GATATC 2 cut(s) 166, 352
EcoRV GATATC 2 cut(s) 166, 352
FaeI CATG 3 cut(s) 117, 323, 425
FaiI YATR 8 cut(s) 115, 201, 266, 321, 329, 407, 423, 455
FatI CATG 3 cut(s) 113, 319, 421
FokI GGATG 1 cut(s) 404
FspBI CTAG 4 cut(s) 24, 179, 282, 375
HaeIII GGCC 1 cut(s) 104
HapII CCGG 1 cut(s) 120
Hin1II CATG 3 cut(s) 117, 323, 425
HincII GTYRAC 1 cut(s) 559
HindII GTYRAC 1 cut(s) 559
HinfI GANTC 2 cut(s) 256, 323
HpaII CCGG 1 cut(s) 120
HphI GGTGA 1 cut(s) 100
Hpy166II GTNNAC 1 cut(s) 559
Hpy188I TCNGA 2 cut(s) 133, 163
Hpy188III TCNNGA 4 cut(s) 8, 59, 226, 320
Hpy8I GTNNAC 1 cut(s) 559
Hpy99I CGWCG 1 cut(s) 392
HpyAV CCTTC 1 cut(s) 262
HpyCH4III ACNGT 2 cut(s) 197, 538
HpyCH4V TGCA 2 cut(s) 78, 482
HpyF10VI GCNNNNNNNGC 1 cut(s) 33
Hsp92II CATG 3 cut(s) 117, 323, 425
Kzo9I GATC 7 cut(s) 4, 48, 55, 96, 316, 370, 516
LguI GCTCTTC 1 cut(s) 296
LpnPI CCDG 4 cut(s) 22, 72, 133, 492
MaeI CTAG 4 cut(s) 24, 179, 282, 375
MalI GATC 7 cut(s) 6, 50, 57, 98, 318, 372, 518
MboI GATC 7 cut(s) 4, 48, 55, 96, 316, 370, 516
MboII GAAGA 8 cut(s) 65, 149, 152, 155, 283, 446, 455, 610
MflI RGATCY 2 cut(s) 55, 370
MluCI AATT 6 cut(s) 12, 108, 174, 437, 470, 627
MlyI GAGTC 1 cut(s) 250
MmeI TCCRAC 2 cut(s) 21, 486
MnlI CCTC 7 cut(s) 94, 127, 145, 196, 402, 442, 504
MseI TTAA 2 cut(s) 219, 637
MspI CCGG 1 cut(s) 120
MspR9I CCNGG 1 cut(s) 120
MwoI GCNNNNNNNGC 1 cut(s) 33
NciI CCSGG 1 cut(s) 120
NdeII GATC 7 cut(s) 4, 48, 55, 96, 316, 370, 516
NlaIII CATG 3 cut(s) 117, 323, 425
NlaIV GGNNCC 1 cut(s) 247
NspI RCATGY 1 cut(s) 117
PagI TCATGA 1 cut(s) 319
PciSI GCTCTTC 1 cut(s) 296
PfeI GAWTC 1 cut(s) 323
Ple19I CGATCG 1 cut(s) 519
PleI GAGTC 1 cut(s) 250
PpsI GAGTC 1 cut(s) 250
PspN4I GGNNCC 1 cut(s) 247
PsuI RGATCY 2 cut(s) 55, 370
PvuI CGATCG 1 cut(s) 519
SapI GCTCTTC 1 cut(s) 296
SaqAI TTAA 2 cut(s) 219, 637
Sau3AI GATC 7 cut(s) 4, 48, 55, 96, 316, 370, 516
SchI GAGTC 1 cut(s) 250
ScrFI CCNGG 1 cut(s) 120
SetI ASST 1 cut(s) 291
Sse9I AATT 6 cut(s) 12, 108, 174, 437, 470, 627
SsiI CCGC 2 cut(s) 249, 359
SspI AATATT 1 cut(s) 342
SspMI CTAG 4 cut(s) 24, 179, 282, 375
StyD4I CCNGG 1 cut(s) 118
TaaI ACNGT 2 cut(s) 197, 538
TaqI TCGA 6 cut(s) 51, 66, 99, 213, 259, 294
TasI AATT 6 cut(s) 12, 108, 174, 437, 470, 627
TfiI GAWTC 1 cut(s) 323
Tru1I TTAA 2 cut(s) 219, 637
Tru9I TTAA 2 cut(s) 219, 637
TscAI CASTG 2 cut(s) 34, 543
TspDTI ATGAA 2 cut(s) 281, 336
TspRI CASTG 2 cut(s) 34, 543
XapI RAATTY 2 cut(s) 174, 470
XceI RCATGY 1 cut(s) 117
XcmI CCANNNNNNNNNTGG 1 cut(s) 88
XspI CTAG 4 cut(s) 24, 179, 282, 375
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.