RLG00000029344

Ring finger domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr6
OG0000735
Physical Location & Seq
Forward (+)
36832046 .. 36835630
3585 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000029344

Sequence Viewer

Length: 672 bp
ATGGATCAGGAAATTGAGAATTCTAGCACTCATTGCTGGTTGGAAAGGATTGACGATCCTAAAATCGAGTTGGGTTGCACCAAGTTGGTTATGGAGATCGAAGCCACAATTACATGTCCCAGCAGATATCCGATGGAAGAAGAAGAAGAAGATGAAGATGATATGGACTACTCCGATATCAATCGAATTCTAGCTCAAGACAGTAACAGTTATGAAGGCACACTCGAACTTAACTTGTTGATGGAAAACAACAGTGGAACGGCCTCAACTCGATTTATGAGGGAAGAAATATCTAAGAAGCTCTTCGACTTGAATGTTCCCTTTAGGAATCATGAATCCATAGCAGATAAAATATTGAACGATGTCTTTGGGGTGACAAGAGATTTTAGTCGTAAAGCCGACGGCAAGATTTTGTGTATGAGGGCTGTTATCCATGTTTTAGGGGAAGAATTGGGAGATGAGGATATGGAAATTGAGGCTAACTTTGTGCCTGCAAGTAAATCGGCAATGGAGAAGTTGGAGAGGCCGATCGTTGTCCAAGTCTCGACAATGTGTTCGACATCTTCGATTGTAGCAAGTAATTCATCTAGGTTGTATCGCTACAGAGACTACATACCCATGCGAGGCCACATAAGTGCCTCCATGGATCGTTTTAGCAATTGGCTCTCGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
zf-RING_2 zf-rbx1

Protein Analysis

224

Amino Acids

25.54

Weight (kDa)

4.57

Isoelectric Point (pI)

46.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 3 cut(s) 12, 50, 654
AcsI RAATTY 2 cut(s) 19, 186
AfiI CCNNNNNNNGG 1 cut(s) 623
AflIII ACRYGT 1 cut(s) 113
AgsI TTSAA 2 cut(s) 313, 358
AleI CACNNNNGTG 1 cut(s) 633
AluBI AGCT 2 cut(s) 194, 301
AluI AGCT 2 cut(s) 194, 301
Alw26I GTCTC 2 cut(s) 547, 600
AlwI GGATC 3 cut(s) 12, 50, 654
AoxI GGCC 3 cut(s) 261, 524, 625
ApoI RAATTY 2 cut(s) 19, 186
ArsI GACNNNNNNTTYG 2 cut(s) 538, 570
Asp700I GAANNNNTTC 1 cut(s) 302
AsuHPI GGTGA 1 cut(s) 385
BccI CCATC 2 cut(s) 127, 235
BceAI ACGGC 2 cut(s) 276, 418
BcgI CGANNNNNNTGC 2 cut(s) 483, 517
BcoDI GTCTC 2 cut(s) 547, 600
BfaI CTAG 3 cut(s) 24, 191, 588
BfmI CTRYAG 1 cut(s) 601
BpuEI CTTGAG 1 cut(s) 180
BsaBI GATNNNNATC 1 cut(s) 180
BsaJI CCNNGG 1 cut(s) 642
Bsc4I CCNNNNNNNGG 1 cut(s) 623
Bse3DI GCAATG 2 cut(s) 31, 513
Bse8I GATNNNNATC 1 cut(s) 180
BseDI CCNNGG 1 cut(s) 642
BseJI GATNNNNATC 1 cut(s) 180
BseLI CCNNNNNNNGG 1 cut(s) 623
BseMI GCAATG 2 cut(s) 31, 513
BseYI CCCAGC 1 cut(s) 119
Bsh1285I CGRYCG 1 cut(s) 531
BshFI GGCC 3 cut(s) 263, 526, 627
BsiEI CGRYCG 1 cut(s) 531
BslFI GGGAC 1 cut(s) 102
BslI CCNNNNNNNGG 1 cut(s) 623
BsmAI GTCTC 2 cut(s) 547, 600
BsmFI GGGAC 1 cut(s) 102
BsnI GGCC 3 cut(s) 263, 526, 627
Bsp143I GATC 5 cut(s) 4, 55, 96, 528, 646
Bsp19I CCATGG 1 cut(s) 642
BspANI GGCC 3 cut(s) 263, 526, 627
BspHI TCATGA 1 cut(s) 331
BspPI GGATC 3 cut(s) 12, 50, 654
BspQI GCTCTTC 1 cut(s) 308
BsrDI GCAATG 2 cut(s) 31, 513
BssECI CCNNGG 1 cut(s) 642
BssMI GATC 5 cut(s) 4, 55, 96, 528, 646
BssT1I CCWWGG 1 cut(s) 642
Bst4CI ACNGT 3 cut(s) 203, 209, 254
Bst6I CTCTTC 1 cut(s) 308
BstAPI GCANNNNNTGC 1 cut(s) 33
BstC8I GCNNGC 1 cut(s) 492
BstDEI CTNAG 1 cut(s) 294
BstDSI CCRYGG 1 cut(s) 642
BstKTI GATC 5 cut(s) 7, 58, 99, 531, 649
BstMAI GTCTC 2 cut(s) 547, 600
BstMBI GATC 5 cut(s) 4, 55, 96, 528, 646
BstMCI CGRYCG 1 cut(s) 531
BstMWI GCNNNNNNNGC 1 cut(s) 33
BstNSI RCATGY 1 cut(s) 117
BstSFI CTRYAG 1 cut(s) 601
BsuRI GGCC 3 cut(s) 263, 526, 627
BtgI CCRYGG 1 cut(s) 642
BtsIMutI CAGTG 1 cut(s) 259
Cac8I GCNNGC 1 cut(s) 492
CciI TCATGA 1 cut(s) 331
CviAII CATG 5 cut(s) 114, 332, 434, 619, 643
DdeI CTNAG 1 cut(s) 294
DpnI GATC 5 cut(s) 6, 57, 98, 530, 648
DpnII GATC 5 cut(s) 4, 55, 96, 528, 646
Eam1104I CTCTTC 1 cut(s) 308
EarI CTCTTC 1 cut(s) 308
Eco130I CCWWGG 1 cut(s) 642
Eco32I GATATC 2 cut(s) 128, 178
EcoRI GAATTC 2 cut(s) 19, 186
EcoRV GATATC 2 cut(s) 128, 178
EcoT14I CCWWGG 1 cut(s) 642
ErhI CCWWGG 1 cut(s) 642
FaeI CATG 5 cut(s) 117, 335, 437, 622, 646
FalI AAGNNNNNCTT 2 cut(s) 287, 319
FaqI GGGAC 1 cut(s) 102
FatI CATG 5 cut(s) 113, 331, 433, 618, 642
FspBI CTAG 3 cut(s) 24, 191, 588
GsaI CCCAGC 1 cut(s) 123
HaeIII GGCC 3 cut(s) 263, 526, 627
Hin1II CATG 5 cut(s) 117, 335, 437, 622, 646
HinfI GANTC 2 cut(s) 328, 335
HphI GGTGA 1 cut(s) 385
Hpy188I TCNGA 2 cut(s) 132, 175
Hpy188III TCNNGA 4 cut(s) 8, 197, 332, 544
Hpy99I CGWCG 1 cut(s) 404
HpyAV CCTTC 1 cut(s) 209
HpyCH4III ACNGT 3 cut(s) 203, 209, 254
HpyCH4V TGCA 2 cut(s) 78, 494
HpyF10VI GCNNNNNNNGC 1 cut(s) 33
HpyF3I CTNAG 1 cut(s) 294
Hsp92II CATG 5 cut(s) 117, 335, 437, 622, 646
Kzo9I GATC 5 cut(s) 4, 55, 96, 528, 646
LguI GCTCTTC 1 cut(s) 308
LpnPI CCDG 3 cut(s) 22, 133, 504
MaeI CTAG 3 cut(s) 24, 191, 588
MaeIII GTNAC 2 cut(s) 203, 373
MalI GATC 5 cut(s) 6, 57, 98, 530, 648
MboI GATC 5 cut(s) 4, 55, 96, 528, 646
MfeI CAATTG 1 cut(s) 658
MluCI AATT 8 cut(s) 12, 19, 108, 186, 449, 471, 580, 658
MmeI TCCRAC 2 cut(s) 21, 498
MnlI CCTC 8 cut(s) 273, 274, 414, 454, 469, 516, 617, 649
MroXI GAANNNNTTC 1 cut(s) 302
MseI TTAA 1 cut(s) 231
MslI CAYNNNNRTG 2 cut(s) 617, 633
MunI CAATTG 1 cut(s) 658
MwoI GCNNNNNNNGC 1 cut(s) 33
NcoI CCATGG 1 cut(s) 642
NdeII GATC 5 cut(s) 4, 55, 96, 528, 646
NlaIII CATG 5 cut(s) 117, 335, 437, 622, 646
NmuCI GTSAC 1 cut(s) 373
NspI RCATGY 1 cut(s) 117
OliI CACNNNNGTG 1 cut(s) 633
PagI TCATGA 1 cut(s) 331
PciI ACATGT 1 cut(s) 113
PciSI GCTCTTC 1 cut(s) 308
PcsI WCGNNNNNNNCGW 1 cut(s) 563
PdmI GAANNNNTTC 1 cut(s) 302
PfeI GAWTC 2 cut(s) 328, 335
Ple19I CGATCG 1 cut(s) 531
PscI ACATGT 1 cut(s) 113
PspFI CCCAGC 1 cut(s) 119
PvuI CGATCG 1 cut(s) 531
RseI CAYNNNNRTG 2 cut(s) 617, 633
SapI GCTCTTC 1 cut(s) 308
SaqAI TTAA 1 cut(s) 231
Sau3AI GATC 5 cut(s) 4, 55, 96, 528, 646
SetI ASST 3 cut(s) 196, 303, 593
SfcI CTRYAG 1 cut(s) 601
SmiMI CAYNNNNRTG 2 cut(s) 617, 633
SmlI CTYRAG 1 cut(s) 195
SmoI CTYRAG 1 cut(s) 195
Sse9I AATT 8 cut(s) 12, 19, 108, 186, 449, 471, 580, 658
SspI AATATT 1 cut(s) 354
SspMI CTAG 3 cut(s) 24, 191, 588
StyI CCWWGG 1 cut(s) 642
TaaI ACNGT 3 cut(s) 203, 209, 254
TaqI TCGA 9 cut(s) 66, 99, 184, 225, 271, 306, 545, 557, 566
TasI AATT 8 cut(s) 12, 19, 108, 186, 449, 471, 580, 658
TfiI GAWTC 2 cut(s) 328, 335
Tru1I TTAA 1 cut(s) 231
Tru9I TTAA 1 cut(s) 231
TscAI CASTG 1 cut(s) 259
TseFI GTSAC 1 cut(s) 373
Tsp45I GTSAC 1 cut(s) 373
TspDTI ATGAA 4 cut(s) 168, 228, 348, 573
TspRI CASTG 1 cut(s) 259
XapI RAATTY 2 cut(s) 19, 186
XceI RCATGY 1 cut(s) 117
XcmI CCANNNNNNNNNTGG 1 cut(s) 88
XmnI GAANNNNTTC 1 cut(s) 302
XspI CTAG 3 cut(s) 24, 191, 588
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.