Rmu_sc0005576.1_g000003

Ring finger domain

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005576.1
Physical Location & Seq
Forward (+)
16261 .. 16563
303 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005576.1_g000003.1.cds

Sequence Viewer

Length: 303 bp
atggaagacatgatgggtgaggttatatttgagtcggcgagtaaaatgtcgattgagaaattggagagggtgagaatagtggaagcatcaaccatgtgtgcgatatgtgcagaggagattgtggttggttccgaagaaattcatatgctatgttcacatttttaccatggcgattacattgtcaagttgttggagcagagcaagttttgcccacaatgtcaatatgttgtgcttgcaacttctaaggatgaaactggaataccactgatcaatagacatgagagagaaggtgttgataattaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

100

Amino Acids

11.37

Weight (kDa)

4.77

Isoelectric Point (pI)

41.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 138
ApoI RAATTY 1 cut(s) 138
Asp700I GAANNNNTTC 1 cut(s) 138
AsuHPI GGTGA 2 cut(s) 29, 82
BbsI GAAGAC 1 cut(s) 12
BccI CCATC 1 cut(s) 7
BclI TGATCA 1 cut(s) 267
BmiI GGNNCC 1 cut(s) 130
BmsI GCATC 1 cut(s) 95
BpiI GAAGAC 1 cut(s) 12
BsaJI CCNNGG 1 cut(s) 166
Bse1I ACTGG 1 cut(s) 259
BseDI CCNNGG 1 cut(s) 166
BseGI GGATG 1 cut(s) 253
BseNI ACTGG 1 cut(s) 259
BseRI GAGGAG 1 cut(s) 128
BsgI GTGCAG 1 cut(s) 129
Bsp143I GATC 1 cut(s) 267
Bsp19I CCATGG 1 cut(s) 166
BspLI GGNNCC 1 cut(s) 130
BsrI ACTGG 1 cut(s) 259
BssECI CCNNGG 1 cut(s) 166
BssMI GATC 1 cut(s) 267
BssT1I CCWWGG 1 cut(s) 166
BstAPI GCANNNNNTGC 1 cut(s) 207
BstC8I GCNNGC 1 cut(s) 234
BstDEI CTNAG 1 cut(s) 243
BstDSI CCRYGG 1 cut(s) 166
BstF5I GGATG 1 cut(s) 253
BstKTI GATC 1 cut(s) 270
BstMBI GATC 1 cut(s) 267
BstMWI GCNNNNNNNGC 2 cut(s) 107, 207
BstV2I GAAGAC 1 cut(s) 12
BtgI CCRYGG 1 cut(s) 166
BtsCI GGATG 1 cut(s) 253
BtsIMutI CAGTG 1 cut(s) 263
Cac8I GCNNGC 1 cut(s) 234
CviAII CATG 4 cut(s) 10, 94, 167, 278
DdeI CTNAG 1 cut(s) 243
DpnI GATC 1 cut(s) 269
DpnII GATC 1 cut(s) 267
Eco130I CCWWGG 1 cut(s) 166
EcoT14I CCWWGG 1 cut(s) 166
ErhI CCWWGG 1 cut(s) 166
FaeI CATG 4 cut(s) 13, 97, 170, 281
FatI CATG 4 cut(s) 9, 93, 166, 277
FauNDI CATATG 1 cut(s) 144
FbaI TGATCA 1 cut(s) 267
FokI GGATG 1 cut(s) 260
Hin1II CATG 4 cut(s) 13, 97, 170, 281
HinfI GANTC 1 cut(s) 32
HphI GGTGA 2 cut(s) 29, 82
Hpy166II GTNNAC 1 cut(s) 155
Hpy188I TCNGA 1 cut(s) 133
Hpy8I GTNNAC 1 cut(s) 155
HpyAV CCTTC 1 cut(s) 281
HpyCH4V TGCA 2 cut(s) 110, 236
HpyF10VI GCNNNNNNNGC 2 cut(s) 107, 207
HpyF3I CTNAG 1 cut(s) 243
Hsp92II CATG 4 cut(s) 13, 97, 170, 281
Ksp22I TGATCA 1 cut(s) 267
Kzo9I GATC 1 cut(s) 267
LmnI GCTCC 1 cut(s) 193
LpnPI CCDG 1 cut(s) 240
LweI GCATC 1 cut(s) 95
MalI GATC 1 cut(s) 269
MboI GATC 1 cut(s) 267
MboII GAAGA 2 cut(s) 17, 146
MluCI AATT 3 cut(s) 59, 138, 298
MlyI GAGTC 1 cut(s) 41
MmeI TCCRAC 1 cut(s) 171
MnlI CCTC 3 cut(s) 13, 60, 106
MroXI GAANNNNTTC 1 cut(s) 138
MseI TTAA 1 cut(s) 301
MwoI GCNNNNNNNGC 2 cut(s) 107, 207
NcoI CCATGG 1 cut(s) 166
NdeI CATATG 1 cut(s) 144
NdeII GATC 1 cut(s) 267
NlaIII CATG 4 cut(s) 13, 97, 170, 281
NlaIV GGNNCC 1 cut(s) 130
PdmI GAANNNNTTC 1 cut(s) 138
PleI GAGTC 1 cut(s) 40
PpsI GAGTC 1 cut(s) 40
PspN4I GGNNCC 1 cut(s) 130
SaqAI TTAA 1 cut(s) 301
Sau3AI GATC 1 cut(s) 267
SchI GAGTC 1 cut(s) 41
SetI ASST 2 cut(s) 24, 292
SfaNI GCATC 1 cut(s) 95
SgeI CNNG 9 cut(s) 22, 51, 106, 179, 196, 214, 245, 267, 290
Sse9I AATT 3 cut(s) 59, 138, 298
StyI CCWWGG 1 cut(s) 166
TaqI TCGA 1 cut(s) 50
TasI AATT 3 cut(s) 59, 138, 298
Tru1I TTAA 1 cut(s) 301
Tru9I TTAA 1 cut(s) 301
TscAI CASTG 1 cut(s) 270
TspDTI ATGAA 2 cut(s) 131, 264
TspRI CASTG 1 cut(s) 270
XapI RAATTY 1 cut(s) 138
XmnI GAANNNNTTC 1 cut(s) 138
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.