Rmu_sc0001969.1_g000007

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001969.1
OG0000735
Physical Location & Seq
Forward (+)
19086 .. 19535
450 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001969.1_g000007.1.cds

Sequence Viewer

Length: 351 bp
atgatcatgacaagtgactactgggaagtggtggacgacgctttctgcgacatacttattaccgtcattgaaccagaaaacaagtttatattcaccaccaataagactataatagaacttgacaactctaactcatcatccatggatgcaatcatatctaagatgcttcgacaattgcaactcccattgcagaagcgtagctccatggtagagagagtaatgttcaaagtccttgaggtggcacagaaacatagttcttatgccggtggaaaaagactgcgtatacatgtggatatcgatatgtatgtgattgataatgatgtgcagatagtggtggtgaaattattgtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

116

Amino Acids

13.38

Weight (kDa)

5.28

Isoelectric Point (pI)

55.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 283
AfiI CCNNNNNNNGG 1 cut(s) 238
AflIII ACRYGT 1 cut(s) 286
AgsI TTSAA 2 cut(s) 71, 226
AluBI AGCT 1 cut(s) 201
AluI AGCT 1 cut(s) 201
AsuHPI GGTGA 2 cut(s) 85, 349
BclI TGATCA 1 cut(s) 3
BmrI ACTGGG 1 cut(s) 31
BmsI GCATC 2 cut(s) 136, 153
BmuI ACTGGG 1 cut(s) 31
BpuEI CTTGAG 1 cut(s) 254
Bsa29I ATCGAT 1 cut(s) 297
BsaJI CCNNGG 2 cut(s) 141, 204
Bsc4I CCNNNNNNNGG 1 cut(s) 238
Bse118I RCCGGY 1 cut(s) 263
Bse1I ACTGG 1 cut(s) 26
Bse3DI GCAATG 1 cut(s) 185
BseCI ATCGAT 1 cut(s) 297
BseDI CCNNGG 2 cut(s) 141, 204
BseGI GGATG 2 cut(s) 137, 151
BseLI CCNNNNNNNGG 1 cut(s) 238
BseMI GCAATG 1 cut(s) 185
BseNI ACTGG 1 cut(s) 26
BsgI GTGCAG 1 cut(s) 344
BshVI ATCGAT 1 cut(s) 297
BsiSI CCGG 1 cut(s) 264
BslI CCNNNNNNNGG 1 cut(s) 238
Bsp143I GATC 1 cut(s) 3
Bsp19I CCATGG 2 cut(s) 141, 204
BspDI ATCGAT 1 cut(s) 297
BspHI TCATGA 1 cut(s) 6
BsrDI GCAATG 1 cut(s) 185
BsrFI RCCGGY 1 cut(s) 263
BsrI ACTGG 1 cut(s) 26
BssAI RCCGGY 1 cut(s) 263
BssECI CCNNGG 2 cut(s) 141, 204
BssMI GATC 1 cut(s) 3
BssNAI GTATAC 1 cut(s) 284
BssT1I CCWWGG 2 cut(s) 141, 204
Bst1107I GTATAC 1 cut(s) 284
Bst4CI ACNGT 1 cut(s) 64
BstDEI CTNAG 1 cut(s) 159
BstDSI CCRYGG 2 cut(s) 141, 204
BstF5I GGATG 2 cut(s) 137, 151
BstKTI GATC 1 cut(s) 6
BstMBI GATC 1 cut(s) 3
BstNSI RCATGY 1 cut(s) 290
BstZ17I GTATAC 1 cut(s) 284
Bsu15I ATCGAT 1 cut(s) 297
BsuTUI ATCGAT 1 cut(s) 297
BtgI CCRYGG 2 cut(s) 141, 204
BtsCI GGATG 2 cut(s) 137, 151
CciI TCATGA 1 cut(s) 6
Cfr10I RCCGGY 1 cut(s) 263
ClaI ATCGAT 1 cut(s) 297
CseI GACGC 1 cut(s) 47
CviAII CATG 4 cut(s) 7, 142, 205, 287
CviJI RGCY 1 cut(s) 201
CviKI_1 RGCY 1 cut(s) 201
DdeI CTNAG 1 cut(s) 159
DpnI GATC 1 cut(s) 5
DpnII GATC 1 cut(s) 3
Eco130I CCWWGG 2 cut(s) 141, 204
Eco32I GATATC 1 cut(s) 295
EcoRV GATATC 1 cut(s) 295
EcoT14I CCWWGG 2 cut(s) 141, 204
ErhI CCWWGG 2 cut(s) 141, 204
FaeI CATG 4 cut(s) 10, 145, 208, 290
FatI CATG 4 cut(s) 6, 141, 204, 286
FbaI TGATCA 1 cut(s) 3
FblI GTMKAC 1 cut(s) 283
FokI GGATG 2 cut(s) 124, 158
HapII CCGG 1 cut(s) 264
HgaI GACGC 1 cut(s) 47
Hin1II CATG 4 cut(s) 10, 145, 208, 290
HpaII CCGG 1 cut(s) 264
HphI GGTGA 2 cut(s) 85, 349
Hpy166II GTNNAC 2 cut(s) 34, 284
Hpy188III TCNNGA 1 cut(s) 7
Hpy8I GTNNAC 2 cut(s) 34, 284
Hpy99I CGWCG 1 cut(s) 41
HpyCH4III ACNGT 1 cut(s) 64
HpyCH4V TGCA 4 cut(s) 149, 178, 190, 325
HpyF3I CTNAG 1 cut(s) 159
Hsp92II CATG 4 cut(s) 10, 145, 208, 290
Ksp22I TGATCA 1 cut(s) 3
Kzo9I GATC 1 cut(s) 3
LmnI GCTCC 1 cut(s) 206
LpnPI CCDG 3 cut(s) 7, 87, 277
LweI GCATC 2 cut(s) 136, 153
MaeIII GTNAC 1 cut(s) 14
MalI GATC 1 cut(s) 5
MboI GATC 1 cut(s) 3
MfeI CAATTG 1 cut(s) 173
MluCI AATT 2 cut(s) 173, 341
MnlI CCTC 1 cut(s) 229
MspI CCGG 1 cut(s) 264
MunI CAATTG 1 cut(s) 173
NcoI CCATGG 2 cut(s) 141, 204
NdeII GATC 1 cut(s) 3
NlaIII CATG 4 cut(s) 10, 145, 208, 290
NmuCI GTSAC 1 cut(s) 14
NspI RCATGY 1 cut(s) 290
PagI TCATGA 1 cut(s) 6
PciI ACATGT 1 cut(s) 286
PcsI WCGNNNNNNNCGW 1 cut(s) 45
PscI ACATGT 1 cut(s) 286
Sau3AI GATC 1 cut(s) 3
SetI ASST 2 cut(s) 203, 240
SfaNI GCATC 2 cut(s) 136, 153
SmlI CTYRAG 1 cut(s) 233
SmoI CTYRAG 1 cut(s) 233
Sse9I AATT 2 cut(s) 173, 341
StyI CCWWGG 2 cut(s) 141, 204
TaaI ACNGT 1 cut(s) 64
TaqI TCGA 2 cut(s) 169, 297
TasI AATT 2 cut(s) 173, 341
TseFI GTSAC 1 cut(s) 14
Tsp45I GTSAC 1 cut(s) 14
XceI RCATGY 1 cut(s) 290
XmiI GTMKAC 1 cut(s) 283
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.