Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8392105.1

Orthogroup ID

OG0001041

Physical Location & Seq

Genomic Coordinates Reverse (-)

243 .. 1172

Gene Structure 930 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8392105.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 930 bp

ctggctgcactcactagattcccaaatctagttcatctggaaatatttgagcttcagacggacttcgaaatagaaatcatagcccagacatgccgcaaaatagagagcatcacggttttctgctttgatgcgcatcaggaaggtcatggtggtattttgaggggaaaaggactaatggctttgggaaatggatgtcccaaattgtccaaagttatgcttgctggggaagacacggtccgggattctggaattattgcacttctacattcaaaacatagctttgacgctttggttttcttatctaatagcttgatcacggatcaagccctcagagcaattggtttggcatcttcaattagcattttggagttggtaggttgttccggcatcaaggatatgggattggggtttttggcaaatgggtctacctcgaaaaccctcaagaaattggtcctaaatctttgccggggaatcactgataccggggtcaagcttttgcagaaaatgtgtagcttggagcacctggaattgtcctactgtgggaggagaggagaaatcactgatattggaggtgtggcaatctctgcaattcaaacgctcaaggaaataaaattggatggtcttctgggtgtatcagaccctaccatgcttgctcttgcccagaattgctgcaacttggaaatacttgatttagagggatgtcaaggtgtaactggagctggcattcgtgcattttcaagtcatcagtgcttgaaacgccttgtgttgctaggcttaaggaactttaatctctctgatgtggagagcgtagcgtttggatgcccctcattggagtcggaatctgttgtggtggattcactgtggaagctggatgcaacattgatgcaggacaacactagaagagtcctcaaattcactgaaatgtcgtag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

LRR_6

Protein Analysis

309

Amino Acids

33.3

Weight (kDa)

5.84

Isoelectric Point (pI)

30.36

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001041)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g40700 FvH4_5g10370 FvH4_5g12160 FvH4_5g12180 FvH4_5g12190 FvH4_5g12200 FvH4_5g12210 FvH4_5g12211
rosa_chinensis	RchiOBHm_Chr5g0073461 RchiOBHm_Chr5g0073471 RchiOBHm_Chr7g0185341 RchiOBHm_Chr7g0185381 RchiOBHm_Chr7g0185401
rosa_laevigata	RLG00000004916 RLG00000004917 RLG00000004921 RLG00000019401 RLG00000036387
rosa_multiflora	Rmu_co8366929.1_g000001 Rmu_co8392105.1_g000001 Rmu_sc0001761.1_g000011 Rmu_sc0001761.1_g000012 Rmu_sc0001761.1_g000013 Rmu_sc0001761.1_g000016 Rmu_sc0004670.1_g000010 Rmu_sc0008496.1_g000005 Rmu_sc0023242.1_g000005 Rmu_sc0023242.1_g000006 Rmu_ssc0000226.1_g000026 Rmu_ssc0000226.1_g000027
rosa_roxburghii	Rroxscaffold_1G00007790 Rroxscaffold_1G00017220 Rroxscaffold_2G00110040 Rroxscaffold_3G00269000 Rroxscaffold_3G00269010
rosa_rugosa	Rorug05G0423700 Rorug06G0468100 Rorug06G0468700
rosa_samantha	Rh2CG354600 Rh2CG354700 Rh2DG393800 Rh5AG481000 Rh5CG455400 Rh5CG524900 Rh5DG514100 Rh7AG074000 Rh7AG074100 Rh7AG074200 Rh7AG074600 Rh7BG072600 Rh7BG073200 Rh7BG073300 Rh7BG073400 Rh7DG073200 Rh7DG073600 Rh7DG073700 Rh7DG073800
rosa_wichuraiana	Rw2G030200 Rw7G006080 Rw7G006120 Rw7G006130

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc16I	TGCGCA	1 cut(s)	132
AccI	GTMKAC	1 cut(s)	425
AciI	CCGC	1 cut(s)	94
AclWI	GGATC	1 cut(s)	327
AcsI	RAATTY	1 cut(s)	911
AcuI	CTGAAG	1 cut(s)	38
AfiI	CCNNNNNNNGG	2 cut(s)	540, 829
AflII	CTTAAG	1 cut(s)	775
AgsI	TTSAA	5 cut(s)	270, 354, 593, 738, 754
AjnI	CCWGG	1 cut(s)	522
AluBI	AGCT	7 cut(s)	52, 279, 309, 493, 513, 719, 868
AluI	AGCT	7 cut(s)	52, 279, 309, 493, 513, 719, 868
Alw21I	GWGCWC	1 cut(s)	522
AlwI	GGATC	1 cut(s)	327
ApeKI	GCWGC	2 cut(s)	5, 669
ApoI	RAATTY	1 cut(s)	911
AspLEI	GCGC	1 cut(s)	133
AspS9I	GGNCC	2 cut(s)	235, 451
AsuC2I	CCSGG	3 cut(s)	239, 467, 484
AsuII	TTCGAA	1 cut(s)	66
AvaII	GGWCC	2 cut(s)	235, 451
BaeI	ACNNNNGTAYC	2 cut(s)	471, 504
BbsI	GAAGAC	2 cut(s)	234, 614
Bbv12I	GWGCWC	1 cut(s)	522
BbvI	GCAGC	1 cut(s)	656
BccI	CCATC	1 cut(s)	611
BciT130I	CCWGG	1 cut(s)	524
BclI	TGATCA	1 cut(s)	312
BcnI	CCSGG	3 cut(s)	239, 467, 484
BfaI	CTAG	4 cut(s)	15, 29, 770, 897
BfrI	CTTAAG	1 cut(s)	775
BisI	GCNGC	3 cut(s)	6, 94, 670
BlsI	GCNGC	3 cut(s)	7, 95, 671
Bme1390I	CCNGG	4 cut(s)	239, 467, 484, 524
Bme18I	GGWCC	2 cut(s)	235, 451
BmgT120I	GGNCC	2 cut(s)	235, 451
BmrFI	CCNGG	4 cut(s)	239, 467, 484, 524
BmsI	GCATC	8 cut(s)	117, 118, 142, 356, 396, 809, 862, 873
BpiI	GAAGAC	2 cut(s)	234, 614
BpmI	CTGGAG	1 cut(s)	735
Bpu14I	TTCGAA	1 cut(s)	66
BpuEI	CTTGAG	2 cut(s)	425, 584
BpuMI	CCSGG	3 cut(s)	239, 467, 484
BsaBI	GATNNNNATC	1 cut(s)	132
BsaJI	CCNNGG	2 cut(s)	466, 483
Bsc4I	CCNNNNNNNGG	2 cut(s)	540, 829
Bse1I	ACTGG	1 cut(s)	718
Bse8I	GATNNNNATC	1 cut(s)	132
BseBI	CCWGG	1 cut(s)	524
BseDI	CCNNGG	2 cut(s)	466, 483
BseGI	GGATG	5 cut(s)	197, 622, 704, 824, 877
BseJI	GATNNNNATC	1 cut(s)	132
BseLI	CCNNNNNNNGG	2 cut(s)	540, 829
BseMII	CTCAG	1 cut(s)	343
BseNI	ACTGG	1 cut(s)	718
BseRI	GAGGAG	2 cut(s)	559, 564
BseXI	GCAGC	1 cut(s)	656
BseYI	CCCAGC	1 cut(s)	221
BsiHKAI	GWGCWC	1 cut(s)	522
BsiSI	CCGG	4 cut(s)	238, 384, 466, 483
BslFI	GGGAC	1 cut(s)	180
BslI	CCNNNNNNNGG	2 cut(s)	540, 829
BsmFI	GGGAC	1 cut(s)	180
BsmI	GAATGC	1 cut(s)	723
Bsp119I	TTCGAA	1 cut(s)	66
Bsp1286I	GDGCHC	1 cut(s)	522
Bsp143I	GATC	2 cut(s)	312, 319
BspACI	CCGC	1 cut(s)	94
BspCNI	CTCAG	1 cut(s)	342
BspPI	GGATC	1 cut(s)	327
BspT104I	TTCGAA	1 cut(s)	66
BspTI	CTTAAG	1 cut(s)	775
BsrI	ACTGG	1 cut(s)	718
BssECI	CCNNGG	2 cut(s)	466, 483
BssMI	GATC	2 cut(s)	312, 319
Bst2UI	CCWGG	1 cut(s)	524
Bst4CI	ACNGT	4 cut(s)	115, 235, 539, 861
Bst6I	CTCTTC	1 cut(s)	895
BstAFI	CTTAAG	1 cut(s)	775
BstAPI	GCANNNNNTGC	1 cut(s)	584
BstBI	TTCGAA	1 cut(s)	66
BstC8I	GCNNGC	3 cut(s)	219, 651, 721
BstDEI	CTNAG	1 cut(s)	329
BstF5I	GGATG	5 cut(s)	197, 622, 704, 824, 877
BstHHI	GCGC	1 cut(s)	133
BstKTI	GATC	2 cut(s)	315, 322
BstMBI	GATC	2 cut(s)	312, 319
BstMWI	GCNNNNNNNGC	3 cut(s)	332, 584, 756
BstNI	CCWGG	1 cut(s)	524
BstNSI	RCATGY	1 cut(s)	93
BstSCI	CCNGG	4 cut(s)	237, 465, 482, 522
BstV1I	GCAGC	1 cut(s)	656
BstV2I	GAAGAC	2 cut(s)	234, 614
BtsCI	GGATG	5 cut(s)	197, 622, 704, 824, 877
BtsIMutI	CAGTG	5 cut(s)	474, 558, 752, 857, 915
Cac8I	GCNNGC	3 cut(s)	219, 651, 721
CfoI	GCGC	1 cut(s)	133
Cfr13I	GGNCC	2 cut(s)	235, 451
CpoI	CGGWCCG	1 cut(s)	235
CseI	GACGC	1 cut(s)	293
CspI	CGGWCCG	1 cut(s)	235
CviAII	CATG	3 cut(s)	90, 146, 646
DdeI	CTNAG	1 cut(s)	329
DpnI	GATC	2 cut(s)	314, 321
DpnII	GATC	2 cut(s)	312, 319
Eam1104I	CTCTTC	1 cut(s)	895
EarI	CTCTTC	1 cut(s)	895
Eco47I	GGWCC	2 cut(s)	235, 451
Eco57I	CTGAAG	1 cut(s)	38
EcoRII	CCWGG	1 cut(s)	522
FaeI	CATG	3 cut(s)	93, 149, 649
FaiI	YATR	7 cut(s)	80, 91, 147, 215, 276, 398, 647
FalI	AAGNNNNNCTT	2 cut(s)	201, 233
FaqI	GGGAC	1 cut(s)	180
FatI	CATG	3 cut(s)	89, 145, 645
FbaI	TGATCA	1 cut(s)	312
FblI	GTMKAC	1 cut(s)	425
Fnu4HI	GCNGC	3 cut(s)	6, 94, 670
FokI	GGATG	5 cut(s)	204, 629, 711, 831, 884
Fsp4HI	GCNGC	3 cut(s)	6, 94, 670
FspAI	RTGCGCAY	1 cut(s)	132
FspBI	CTAG	4 cut(s)	15, 29, 770, 897
FspI	TGCGCA	1 cut(s)	132
GlaI	GCGC	1 cut(s)	132
GluI	GCNGC	3 cut(s)	6, 94, 670
GsaI	CCCAGC	1 cut(s)	225
GsuI	CTGGAG	1 cut(s)	735
HapII	CCGG	4 cut(s)	238, 384, 466, 483
HgaI	GACGC	1 cut(s)	293
HhaI	GCGC	1 cut(s)	133
Hin1II	CATG	3 cut(s)	93, 149, 649
Hin6I	GCGC	1 cut(s)	131
HinP1I	GCGC	1 cut(s)	131
HindIII	AAGCTT	1 cut(s)	491
HinfI	GANTC	7 cut(s)	18, 242, 471, 833, 839, 854, 903
HpaII	CCGG	4 cut(s)	238, 384, 466, 483
Hpy166II	GTNNAC	1 cut(s)	426
Hpy188I	TCNGA	5 cut(s)	57, 332, 637, 796, 838
Hpy188III	TCNNGA	4 cut(s)	38, 137, 246, 442
Hpy8I	GTNNAC	1 cut(s)	426
HpyAV	CCTTC	1 cut(s)	134
HpyCH4III	ACNGT	4 cut(s)	115, 235, 539, 861
HpyCH4V	TGCA	8 cut(s)	8, 257, 499, 587, 672, 731, 875, 886
HpyF10VI	GCNNNNNNNGC	3 cut(s)	332, 584, 756
HpyF3I	CTNAG	1 cut(s)	329
Hsp92II	CATG	3 cut(s)	93, 149, 649
HspAI	GCGC	1 cut(s)	131
Ksp22I	TGATCA	1 cut(s)	312
Kzo9I	GATC	2 cut(s)	312, 319
LmnI	GCTCC	2 cut(s)	517, 716
Lsp1109I	GCAGC	1 cut(s)	656
LweI	GCATC	8 cut(s)	117, 118, 142, 356, 396, 809, 862, 873
MaeI	CTAG	4 cut(s)	15, 29, 770, 897
MaeIII	GTNAC	1 cut(s)	709
MalI	GATC	2 cut(s)	314, 321
MboI	GATC	2 cut(s)	312, 319
MboII	GAAGA	4 cut(s)	239, 342, 614, 912
MfeI	CAATTG	1 cut(s)	336
MhlI	GDGCHC	1 cut(s)	522
MlyI	GAGTC	2 cut(s)	842, 912
MmeI	TCCRAC	1 cut(s)	816
MseI	TTAA	2 cut(s)	776, 786
MslI	CAYNNNNRTG	1 cut(s)	920
MspCI	CTTAAG	1 cut(s)	775
MspI	CCGG	4 cut(s)	238, 384, 466, 483
MspR9I	CCNGG	4 cut(s)	239, 467, 484, 524
MunI	CAATTG	1 cut(s)	336
Mva1269I	GAATGC	1 cut(s)	723
MvaI	CCWGG	1 cut(s)	524
MwoI	GCNNNNNNNGC	3 cut(s)	332, 584, 756
NciI	CCSGG	3 cut(s)	239, 467, 484
NdeII	GATC	2 cut(s)	312, 319
NlaIII	CATG	3 cut(s)	93, 149, 649
NsbI	TGCGCA	1 cut(s)	132
NspI	RCATGY	1 cut(s)	93
NspV	TTCGAA	1 cut(s)	66
PctI	GAATGC	1 cut(s)	723
PfeI	GAWTC	5 cut(s)	18, 242, 471, 839, 854
PflFI	GACNNNGTC	1 cut(s)	233
PfoI	TCCNGGA	1 cut(s)	237
PkrI	GCNGC	3 cut(s)	7, 95, 671
PleI	GAGTC	2 cut(s)	841, 911
PpsI	GAGTC	2 cut(s)	841, 911
Psp6I	CCWGG	1 cut(s)	522
PspFI	CCCAGC	1 cut(s)	221
PspGI	CCWGG	1 cut(s)	522
PspPI	GGNCC	2 cut(s)	235, 451
PsyI	GACNNNGTC	1 cut(s)	233
RseI	CAYNNNNRTG	1 cut(s)	920
Rsr2I	CGGWCCG	1 cut(s)	235
RsrII	CGGWCCG	1 cut(s)	235
SaqAI	TTAA	2 cut(s)	776, 786
SatI	GCNGC	3 cut(s)	6, 94, 670
Sau3AI	GATC	2 cut(s)	312, 319
Sau96I	GGNCC	2 cut(s)	235, 451
SchI	GAGTC	2 cut(s)	842, 912
ScrFI	CCNGG	4 cut(s)	239, 467, 484, 524
SduI	GDGCHC	1 cut(s)	522
SfaNI	GCATC	8 cut(s)	117, 118, 142, 356, 396, 809, 862, 873
SfuI	TTCGAA	1 cut(s)	66
SinI	GGWCC	2 cut(s)	235, 451
SmiMI	CAYNNNNRTG	1 cut(s)	920
SmlI	CTYRAG	3 cut(s)	440, 599, 775
SmoI	CTYRAG	3 cut(s)	440, 599, 775
SsiI	CCGC	1 cut(s)	94
SspI	AATATT	1 cut(s)	45
SspMI	CTAG	4 cut(s)	15, 29, 770, 897
StyD4I	CCNGG	4 cut(s)	237, 465, 482, 522
TaaI	ACNGT	4 cut(s)	115, 235, 539, 861
TaqI	TCGA	2 cut(s)	66, 431
TauI	GCSGC	1 cut(s)	96
TfiI	GAWTC	5 cut(s)	18, 242, 471, 839, 854
Tru1I	TTAA	2 cut(s)	776, 786
Tru9I	TTAA	2 cut(s)	776, 786
TscAI	CASTG	5 cut(s)	481, 565, 752, 864, 922
TseI	GCWGC	2 cut(s)	5, 669
TspDTI	ATGAA	1 cut(s)	23
TspGWI	ACGGA	2 cut(s)	74, 332
TspRI	CASTG	5 cut(s)	481, 565, 752, 864, 922
Tth111I	GACNNNGTC	1 cut(s)	233
Vha464I	CTTAAG	1 cut(s)	775
VpaK11BI	GGWCC	2 cut(s)	235, 451
XapI	RAATTY	1 cut(s)	911
XceI	RCATGY	1 cut(s)	93
XmiI	GTMKAC	1 cut(s)	425
XspI	CTAG	4 cut(s)	15, 29, 770, 897

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.