Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001761.1

Orthogroup ID

OG0001041

Physical Location & Seq

Genomic Coordinates Forward (+)

55683 .. 56762

Gene Structure 1080 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001761.1_g000012.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1080 bp

atgagcgatgattttgttggtccaatcattagcaaggttagcatcaaagatgatagaaaatcgttctctgaggtctgcaagcaatggtttaaagtggtaggtctaagccgatcatcacttcgcgttttcgctgaccgacctggcttttccctggctgcactcactagattcccaaatctagttcatctggaaatatttgagcttcagacggacttcgaaatagaaatcatagcccagacatgccgcaaaatagagagcatcacggttttctgctttgatgcgcatcaggaaggtcatggtggtattttgaggggaaaaggactaatggctttgggaaatggatgtcccaaattgtccaaagttatgcttgctggggaagacacggtccgggattctggaattattgcacttctacattcaaaaaatagctttgacgctttggttttcttatctaatagcttgatcacggatcaagccctcagagcaattggtttggcatcttcaattagcattttggagttggtaggttgttccggcatcaaggatatgggattggggtttttggcaaatgggtctacctcgaaaaccctcaagaaattggtcctaaatctttgccggggaatcactgatactggggtcaagcttttgcagaaaatgtgtagcttggagcacctggaattgtcctactgtgggaggagaggagaaatcactgatattggaggtgtggcaatctctgcaattcaaacgctcaaggaaataaaattggatggtcttctgggtgtatcagaccctaccatgcttgctcttgcccagaattgctgcaacttggaaatacttgatttagagggatgtcaaggtgtaactggagctggcattcgtgcattttcaagtcatcagtgcttgaaacgccttgtgttgctaggcttaaggaactttaatctctctgatgtggagagcgtagcgtttggatgcccctcattggagtcggaatctgttgtggtggattcactgtggaagctggatgcaacattgatgcaggacaacactagaagagtcctcaaattcactgaaatgtcgtag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

LRR_6

Protein Analysis

359

Amino Acids

38.91

Weight (kDa)

6.33

Isoelectric Point (pI)

30.84

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001041)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g40700 FvH4_5g10370 FvH4_5g12160 FvH4_5g12180 FvH4_5g12190 FvH4_5g12200 FvH4_5g12210 FvH4_5g12211
rosa_chinensis	RchiOBHm_Chr5g0073461 RchiOBHm_Chr5g0073471 RchiOBHm_Chr7g0185341 RchiOBHm_Chr7g0185381 RchiOBHm_Chr7g0185401
rosa_laevigata	RLG00000004916 RLG00000004917 RLG00000004921 RLG00000019401 RLG00000036387
rosa_multiflora	Rmu_co8366929.1_g000001 Rmu_co8392105.1_g000001 Rmu_sc0001761.1_g000011 Rmu_sc0001761.1_g000012 Rmu_sc0001761.1_g000013 Rmu_sc0001761.1_g000016 Rmu_sc0004670.1_g000010 Rmu_sc0008496.1_g000005 Rmu_sc0023242.1_g000005 Rmu_sc0023242.1_g000006 Rmu_ssc0000226.1_g000026 Rmu_ssc0000226.1_g000027
rosa_roxburghii	Rroxscaffold_1G00007790 Rroxscaffold_1G00017220 Rroxscaffold_2G00110040 Rroxscaffold_3G00269000 Rroxscaffold_3G00269010
rosa_rugosa	Rorug05G0423700 Rorug06G0468100 Rorug06G0468700
rosa_samantha	Rh2CG354600 Rh2CG354700 Rh2DG393800 Rh5AG481000 Rh5CG455400 Rh5CG524900 Rh5DG514100 Rh7AG074000 Rh7AG074100 Rh7AG074200 Rh7AG074600 Rh7BG072600 Rh7BG073200 Rh7BG073300 Rh7BG073400 Rh7DG073200 Rh7DG073600 Rh7DG073700 Rh7DG073800
rosa_wichuraiana	Rw2G030200 Rw7G006080 Rw7G006120 Rw7G006130

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc16I	TGCGCA	1 cut(s)	282
AccI	GTMKAC	1 cut(s)	575
AccII	CGCG	1 cut(s)	123
AciI	CCGC	1 cut(s)	244
AclWI	GGATC	1 cut(s)	477
AcsI	RAATTY	1 cut(s)	1061
AcuI	CTGAAG	1 cut(s)	188
AfiI	CCNNNNNNNGG	2 cut(s)	690, 979
AflII	CTTAAG	1 cut(s)	925
AgsI	TTSAA	5 cut(s)	420, 504, 743, 888, 904
AjnI	CCWGG	3 cut(s)	139, 150, 672
AluBI	AGCT	7 cut(s)	202, 429, 459, 643, 663, 869, 1018
AluI	AGCT	7 cut(s)	202, 429, 459, 643, 663, 869, 1018
Alw21I	GWGCWC	1 cut(s)	672
AlwI	GGATC	1 cut(s)	477
ApeKI	GCWGC	2 cut(s)	155, 819
ApoI	RAATTY	1 cut(s)	1061
AspLEI	GCGC	1 cut(s)	283
AspS9I	GGNCC	3 cut(s)	20, 385, 601
AsuC2I	CCSGG	2 cut(s)	389, 617
AsuII	TTCGAA	1 cut(s)	216
AvaII	GGWCC	3 cut(s)	20, 385, 601
BaeI	ACNNNNGTAYC	2 cut(s)	621, 654
BbsI	GAAGAC	2 cut(s)	384, 764
Bbv12I	GWGCWC	1 cut(s)	672
BbvI	GCAGC	2 cut(s)	142, 806
BccI	CCATC	1 cut(s)	761
BciT130I	CCWGG	3 cut(s)	141, 152, 674
BclI	TGATCA	1 cut(s)	462
BcnI	CCSGG	2 cut(s)	389, 617
BfaI	CTAG	4 cut(s)	165, 179, 920, 1047
BfrI	CTTAAG	1 cut(s)	925
BisI	GCNGC	3 cut(s)	156, 244, 820
BlsI	GCNGC	3 cut(s)	157, 245, 821
Bme1390I	CCNGG	5 cut(s)	141, 152, 389, 617, 674
Bme18I	GGWCC	3 cut(s)	20, 385, 601
BmgT120I	GGNCC	3 cut(s)	20, 385, 601
BmrFI	CCNGG	5 cut(s)	141, 152, 389, 617, 674
BmrI	ACTGGG	1 cut(s)	642
BmsI	GCATC	9 cut(s)	51, 267, 268, 292, 506, 546, 959, 1012, 1023
BmuI	ACTGGG	1 cut(s)	642
BpiI	GAAGAC	2 cut(s)	384, 764
BpmI	CTGGAG	1 cut(s)	885
Bpu14I	TTCGAA	1 cut(s)	216
BpuEI	CTTGAG	2 cut(s)	575, 734
BpuMI	CCSGG	2 cut(s)	389, 617
BsaBI	GATNNNNATC	1 cut(s)	282
BsaJI	CCNNGG	2 cut(s)	150, 616
Bsc4I	CCNNNNNNNGG	2 cut(s)	690, 979
Bse1I	ACTGG	2 cut(s)	637, 868
Bse3DI	GCAATG	1 cut(s)	89
Bse8I	GATNNNNATC	1 cut(s)	282
BseBI	CCWGG	3 cut(s)	141, 152, 674
BseDI	CCNNGG	2 cut(s)	150, 616
BseGI	GGATG	5 cut(s)	347, 772, 854, 974, 1027
BseJI	GATNNNNATC	1 cut(s)	282
BseLI	CCNNNNNNNGG	2 cut(s)	690, 979
BseMI	GCAATG	1 cut(s)	89
BseMII	CTCAG	2 cut(s)	60, 493
BseNI	ACTGG	2 cut(s)	637, 868
BseRI	GAGGAG	2 cut(s)	709, 714
BseXI	GCAGC	2 cut(s)	142, 806
BseYI	CCCAGC	1 cut(s)	371
BsgI	GTGCAG	1 cut(s)	141
Bsh1236I	CGCG	1 cut(s)	123
BsiHKAI	GWGCWC	1 cut(s)	672
BsiSI	CCGG	3 cut(s)	388, 534, 616
BslFI	GGGAC	1 cut(s)	330
BslI	CCNNNNNNNGG	2 cut(s)	690, 979
BsmFI	GGGAC	1 cut(s)	330
BsmI	GAATGC	1 cut(s)	873
Bsp119I	TTCGAA	1 cut(s)	216
Bsp1286I	GDGCHC	1 cut(s)	672
Bsp143I	GATC	3 cut(s)	110, 462, 469
BspACI	CCGC	1 cut(s)	244
BspCNI	CTCAG	2 cut(s)	61, 492
BspFNI	CGCG	1 cut(s)	123
BspPI	GGATC	1 cut(s)	477
BspT104I	TTCGAA	1 cut(s)	216
BspTI	CTTAAG	1 cut(s)	925
BsrDI	GCAATG	1 cut(s)	89
BsrI	ACTGG	2 cut(s)	637, 868
BssECI	CCNNGG	2 cut(s)	150, 616
BssMI	GATC	3 cut(s)	110, 462, 469
Bst2UI	CCWGG	3 cut(s)	141, 152, 674
Bst4CI	ACNGT	4 cut(s)	265, 385, 689, 1011
Bst6I	CTCTTC	1 cut(s)	1045
BstAFI	CTTAAG	1 cut(s)	925
BstAPI	GCANNNNNTGC	1 cut(s)	734
BstBI	TTCGAA	1 cut(s)	216
BstC8I	GCNNGC	4 cut(s)	80, 369, 801, 871
BstDEI	CTNAG	3 cut(s)	69, 104, 479
BstF5I	GGATG	5 cut(s)	347, 772, 854, 974, 1027
BstFNI	CGCG	1 cut(s)	123
BstHHI	GCGC	1 cut(s)	283
BstKTI	GATC	3 cut(s)	113, 465, 472
BstMBI	GATC	3 cut(s)	110, 462, 469
BstMWI	GCNNNNNNNGC	4 cut(s)	39, 482, 734, 906
BstNI	CCWGG	3 cut(s)	141, 152, 674
BstNSI	RCATGY	1 cut(s)	243
BstSCI	CCNGG	5 cut(s)	139, 150, 387, 615, 672
BstUI	CGCG	1 cut(s)	123
BstV1I	GCAGC	2 cut(s)	142, 806
BstV2I	GAAGAC	2 cut(s)	384, 764
BtgZI	GCGATG	1 cut(s)	21
BtsCI	GGATG	5 cut(s)	347, 772, 854, 974, 1027
BtsIMutI	CAGTG	5 cut(s)	624, 708, 902, 1007, 1065
Cac8I	GCNNGC	4 cut(s)	80, 369, 801, 871
CfoI	GCGC	1 cut(s)	283
Cfr13I	GGNCC	3 cut(s)	20, 385, 601
CpoI	CGGWCCG	1 cut(s)	385
CseI	GACGC	1 cut(s)	443
CspI	CGGWCCG	1 cut(s)	385
CviAII	CATG	3 cut(s)	240, 296, 796
DdeI	CTNAG	3 cut(s)	69, 104, 479
DpnI	GATC	3 cut(s)	112, 464, 471
DpnII	GATC	3 cut(s)	110, 462, 469
DraI	TTTAAA	1 cut(s)	91
Eam1104I	CTCTTC	1 cut(s)	1045
EarI	CTCTTC	1 cut(s)	1045
Eco47I	GGWCC	3 cut(s)	20, 385, 601
Eco57I	CTGAAG	1 cut(s)	188
EcoRII	CCWGG	3 cut(s)	139, 150, 672
FaeI	CATG	3 cut(s)	243, 299, 799
FaiI	YATR	6 cut(s)	230, 241, 297, 365, 548, 797
FalI	AAGNNNNNCTT	2 cut(s)	351, 383
FaqI	GGGAC	1 cut(s)	330
FatI	CATG	3 cut(s)	239, 295, 795
FbaI	TGATCA	1 cut(s)	462
FblI	GTMKAC	1 cut(s)	575
Fnu4HI	GCNGC	3 cut(s)	156, 244, 820
FokI	GGATG	5 cut(s)	354, 779, 861, 981, 1034
Fsp4HI	GCNGC	3 cut(s)	156, 244, 820
FspAI	RTGCGCAY	1 cut(s)	282
FspBI	CTAG	4 cut(s)	165, 179, 920, 1047
FspI	TGCGCA	1 cut(s)	282
GlaI	GCGC	1 cut(s)	282
GluI	GCNGC	3 cut(s)	156, 244, 820
GsaI	CCCAGC	1 cut(s)	375
GsuI	CTGGAG	1 cut(s)	885
HapII	CCGG	3 cut(s)	388, 534, 616
HgaI	GACGC	1 cut(s)	443
HhaI	GCGC	1 cut(s)	283
Hin1II	CATG	3 cut(s)	243, 299, 799
Hin6I	GCGC	1 cut(s)	281
HinP1I	GCGC	1 cut(s)	281
HindIII	AAGCTT	1 cut(s)	641
HinfI	GANTC	7 cut(s)	168, 392, 621, 983, 989, 1004, 1053
HpaII	CCGG	3 cut(s)	388, 534, 616
Hpy166II	GTNNAC	1 cut(s)	576
Hpy188I	TCNGA	6 cut(s)	70, 207, 482, 787, 946, 988
Hpy188III	TCNNGA	4 cut(s)	188, 287, 396, 592
Hpy8I	GTNNAC	1 cut(s)	576
HpyAV	CCTTC	1 cut(s)	284
HpyCH4III	ACNGT	4 cut(s)	265, 385, 689, 1011
HpyCH4V	TGCA	9 cut(s)	78, 158, 407, 649, 737, 822, 881, 1025, 1036
HpyF10VI	GCNNNNNNNGC	4 cut(s)	39, 482, 734, 906
HpyF3I	CTNAG	3 cut(s)	69, 104, 479
Hsp92II	CATG	3 cut(s)	243, 299, 799
HspAI	GCGC	1 cut(s)	281
Ksp22I	TGATCA	1 cut(s)	462
Kzo9I	GATC	3 cut(s)	110, 462, 469
LmnI	GCTCC	2 cut(s)	667, 866
Lsp1109I	GCAGC	2 cut(s)	142, 806
LweI	GCATC	9 cut(s)	51, 267, 268, 292, 506, 546, 959, 1012, 1023
MaeI	CTAG	4 cut(s)	165, 179, 920, 1047
MaeIII	GTNAC	1 cut(s)	859
MalI	GATC	3 cut(s)	112, 464, 471
MboI	GATC	3 cut(s)	110, 462, 469
MboII	GAAGA	4 cut(s)	389, 492, 764, 1062
MfeI	CAATTG	1 cut(s)	486
MhlI	GDGCHC	1 cut(s)	672
MlyI	GAGTC	2 cut(s)	992, 1062
MmeI	TCCRAC	1 cut(s)	966
MseI	TTAA	3 cut(s)	90, 926, 936
MslI	CAYNNNNRTG	1 cut(s)	1070
MspCI	CTTAAG	1 cut(s)	925
MspI	CCGG	3 cut(s)	388, 534, 616
MspR9I	CCNGG	5 cut(s)	141, 152, 389, 617, 674
MunI	CAATTG	1 cut(s)	486
Mva1269I	GAATGC	1 cut(s)	873
MvaI	CCWGG	3 cut(s)	141, 152, 674
MvnI	CGCG	1 cut(s)	123
MwoI	GCNNNNNNNGC	4 cut(s)	39, 482, 734, 906
NciI	CCSGG	2 cut(s)	389, 617
NdeII	GATC	3 cut(s)	110, 462, 469
NlaIII	CATG	3 cut(s)	243, 299, 799
NsbI	TGCGCA	1 cut(s)	282
NspI	RCATGY	1 cut(s)	243
NspV	TTCGAA	1 cut(s)	216
PctI	GAATGC	1 cut(s)	873
PfeI	GAWTC	5 cut(s)	168, 392, 621, 989, 1004
PflFI	GACNNNGTC	1 cut(s)	383
PfoI	TCCNGGA	1 cut(s)	387
PkrI	GCNGC	3 cut(s)	157, 245, 821
PleI	GAGTC	2 cut(s)	991, 1061
PpsI	GAGTC	2 cut(s)	991, 1061
Psp6I	CCWGG	3 cut(s)	139, 150, 672
PspFI	CCCAGC	1 cut(s)	371
PspGI	CCWGG	3 cut(s)	139, 150, 672
PspPI	GGNCC	3 cut(s)	20, 385, 601
PsyI	GACNNNGTC	1 cut(s)	383
RseI	CAYNNNNRTG	1 cut(s)	1070
Rsr2I	CGGWCCG	1 cut(s)	385
RsrII	CGGWCCG	1 cut(s)	385
SaqAI	TTAA	3 cut(s)	90, 926, 936
SatI	GCNGC	3 cut(s)	156, 244, 820
Sau3AI	GATC	3 cut(s)	110, 462, 469
Sau96I	GGNCC	3 cut(s)	20, 385, 601
SchI	GAGTC	2 cut(s)	992, 1062
ScrFI	CCNGG	5 cut(s)	141, 152, 389, 617, 674
SduI	GDGCHC	1 cut(s)	672
SfaNI	GCATC	9 cut(s)	51, 267, 268, 292, 506, 546, 959, 1012, 1023
SfuI	TTCGAA	1 cut(s)	216
SinI	GGWCC	3 cut(s)	20, 385, 601
SmiMI	CAYNNNNRTG	1 cut(s)	1070
SmlI	CTYRAG	3 cut(s)	590, 749, 925
SmoI	CTYRAG	3 cut(s)	590, 749, 925
SsiI	CCGC	1 cut(s)	244
SspI	AATATT	1 cut(s)	195
SspMI	CTAG	4 cut(s)	165, 179, 920, 1047
StyD4I	CCNGG	5 cut(s)	139, 150, 387, 615, 672
TaaI	ACNGT	4 cut(s)	265, 385, 689, 1011
TaqI	TCGA	2 cut(s)	216, 581
TaqII	GACCGA	1 cut(s)	150
TauI	GCSGC	1 cut(s)	246
TfiI	GAWTC	5 cut(s)	168, 392, 621, 989, 1004
Tru1I	TTAA	3 cut(s)	90, 926, 936
Tru9I	TTAA	3 cut(s)	90, 926, 936
TscAI	CASTG	5 cut(s)	631, 715, 902, 1014, 1072
TseI	GCWGC	2 cut(s)	155, 819
TspDTI	ATGAA	1 cut(s)	173
TspGWI	ACGGA	2 cut(s)	224, 482
TspRI	CASTG	5 cut(s)	631, 715, 902, 1014, 1072
Tth111I	GACNNNGTC	1 cut(s)	383
Vha464I	CTTAAG	1 cut(s)	925
VpaK11BI	GGWCC	3 cut(s)	20, 385, 601
XapI	RAATTY	1 cut(s)	1061
XceI	RCATGY	1 cut(s)	243
XmiI	GTMKAC	1 cut(s)	575
XspI	CTAG	4 cut(s)	165, 179, 920, 1047

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.