Rorug06G0468700

F-box LRR-repeat protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000006
OG0001041
Physical Location & Seq
Reverse (-)
59270741 .. 59271338
598 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug06G0468700.1

Sequence Viewer

Length: 369 bp
ATGGGTATTTATGAATATTTGTGGAAACATGCTTTGAACTCTGACGAAACCTATGAAGGCATACACAAATATTGTGACTTTGTATCTGATATTTTCTCGAGCAAGTGCACAAAATATCAAATTCAAGCAAGTAATGAGCCTGGAGACGTTGATATCTACAACATCTACGCTCCACTTTGCAAAATATCATCCTCATCAGATACCACATACATCTCAATCGGTTCTGCACTAAATCTTAAGGAGGTCCAAGCTTCATGTAAAACCTACACATTGGTCAGCTTGCAGTGCTATTGGATGGACAGACAGCCCACCAACAATCCTACCCACAAAGCGTCTCCTAGAAAGTGGGATAACAGCGTGGATATATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LRR_6

Protein Analysis

122

Amino Acids

13.95

Weight (kDa)

5.48

Isoelectric Point (pI)

36.86

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Peptidase_S10 PF00450 3 - 98 7e-06 Serine carboxypeptidase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 120
AflII CTTAAG 1 cut(s) 236
AgsI TTSAA 2 cut(s) 37, 125
AjnI CCWGG 1 cut(s) 139
AluBI AGCT 2 cut(s) 251, 279
AluI AGCT 2 cut(s) 251, 279
Alw21I GWGCWC 1 cut(s) 110
Alw26I GTCTC 2 cut(s) 138, 339
Alw44I GTGCAC 1 cut(s) 106
Ama87I CYCGRG 1 cut(s) 97
ApaLI GTGCAC 1 cut(s) 106
ApoI RAATTY 1 cut(s) 120
AspS9I GGNCC 1 cut(s) 244
AvaI CYCGRG 1 cut(s) 97
AvaII GGWCC 1 cut(s) 244
BaeGI GKGCMC 1 cut(s) 110
Bbv12I GWGCWC 1 cut(s) 110
BccI CCATC 1 cut(s) 289
BciT130I CCWGG 1 cut(s) 141
BcoDI GTCTC 2 cut(s) 138, 339
BfaI CTAG 1 cut(s) 339
BfrI CTTAAG 1 cut(s) 236
Bme1390I CCNGG 1 cut(s) 141
Bme18I GGWCC 1 cut(s) 244
BmeT110I CYCGRG 1 cut(s) 97
BmgT120I GGNCC 1 cut(s) 244
BmrFI CCNGG 1 cut(s) 141
BpmI CTGGAG 1 cut(s) 162
BseBI CCWGG 1 cut(s) 141
BseGI GGATG 2 cut(s) 188, 300
BseSI GKGCMC 1 cut(s) 110
BsgI GTGCAG 1 cut(s) 210
BsiHKAI GWGCWC 1 cut(s) 110
BsiHKCI CYCGRG 1 cut(s) 97
BsmAI GTCTC 2 cut(s) 138, 339
BsmBI CGTCTC 2 cut(s) 138, 339
BsoBI CYCGRG 1 cut(s) 97
Bsp1286I GDGCHC 1 cut(s) 110
BspTI CTTAAG 1 cut(s) 236
Bst2UI CCWGG 1 cut(s) 141
BstAFI CTTAAG 1 cut(s) 236
BstC8I GCNNGC 1 cut(s) 281
BstF5I GGATG 2 cut(s) 188, 300
BstMAI GTCTC 2 cut(s) 138, 339
BstMWI GCNNNNNNNGC 1 cut(s) 285
BstNI CCWGG 1 cut(s) 141
BstNSI RCATGY 1 cut(s) 32
BstSCI CCNGG 1 cut(s) 139
BstSLI GKGCMC 1 cut(s) 110
BtsCI GGATG 2 cut(s) 188, 300
BtsI GCAGTG 1 cut(s) 290
BtsIMutI CAGTG 1 cut(s) 290
Cac8I GCNNGC 1 cut(s) 281
Cfr13I GGNCC 1 cut(s) 244
CseI GACGC 1 cut(s) 321
CviAII CATG 2 cut(s) 29, 255
CviJI RGCY 4 cut(s) 139, 251, 279, 307
CviKI_1 RGCY 4 cut(s) 139, 251, 279, 307
Eco32I GATATC 1 cut(s) 154
Eco47I GGWCC 1 cut(s) 244
Eco88I CYCGRG 1 cut(s) 97
EcoRII CCWGG 1 cut(s) 139
EcoRV GATATC 1 cut(s) 154
Esp3I CGTCTC 2 cut(s) 138, 339
FaeI CATG 2 cut(s) 32, 258
FaiI YATR 8 cut(s) 12, 30, 54, 62, 208, 256, 365, 367
FatI CATG 2 cut(s) 28, 254
FokI GGATG 2 cut(s) 175, 307
FspBI CTAG 1 cut(s) 339
GsuI CTGGAG 1 cut(s) 162
HgaI GACGC 1 cut(s) 321
Hin1II CATG 2 cut(s) 32, 258
HindIII AAGCTT 1 cut(s) 249
Hpy166II GTNNAC 1 cut(s) 108
Hpy188I TCNGA 3 cut(s) 43, 88, 199
Hpy188III TCNNGA 1 cut(s) 97
Hpy8I GTNNAC 1 cut(s) 108
HpyAV CCTTC 1 cut(s) 50
HpyCH4IV ACGT 1 cut(s) 147
HpyCH4V TGCA 4 cut(s) 108, 180, 227, 283
HpyF10VI GCNNNNNNNGC 1 cut(s) 285
HpySE526I ACGT 1 cut(s) 147
Hsp92II CATG 2 cut(s) 32, 258
LmnI GCTCC 1 cut(s) 175
LpnPI CCDG 2 cut(s) 126, 153
MaeI CTAG 1 cut(s) 339
MaeII ACGT 1 cut(s) 147
MaeIII GTNAC 1 cut(s) 74
MhlI GDGCHC 1 cut(s) 110
MluCI AATT 1 cut(s) 120
MnlI CCTC 2 cut(s) 202, 235
MseI TTAA 1 cut(s) 237
MspCI CTTAAG 1 cut(s) 236
MspR9I CCNGG 1 cut(s) 141
MvaI CCWGG 1 cut(s) 141
MwoI GCNNNNNNNGC 1 cut(s) 285
NlaIII CATG 2 cut(s) 32, 258
NmuCI GTSAC 1 cut(s) 74
NspI RCATGY 1 cut(s) 32
PaeR7I CTCGAG 1 cut(s) 97
Psp6I CCWGG 1 cut(s) 139
PspGI CCWGG 1 cut(s) 139
PspPI GGNCC 1 cut(s) 244
SaqAI TTAA 1 cut(s) 237
Sau96I GGNCC 1 cut(s) 244
ScrFI CCNGG 1 cut(s) 141
SduI GDGCHC 1 cut(s) 110
SetI ASST 6 cut(s) 53, 150, 246, 253, 266, 281
Sfr274I CTCGAG 1 cut(s) 97
SinI GGWCC 1 cut(s) 244
SlaI CTCGAG 1 cut(s) 97
SmlI CTYRAG 2 cut(s) 97, 236
SmoI CTYRAG 2 cut(s) 97, 236
Sse9I AATT 1 cut(s) 120
SspI AATATT 2 cut(s) 17, 71
SspMI CTAG 1 cut(s) 339
StyD4I CCNGG 1 cut(s) 139
TaiI ACGT 1 cut(s) 150
TaqI TCGA 1 cut(s) 98
TasI AATT 1 cut(s) 120
Tru1I TTAA 1 cut(s) 237
Tru9I TTAA 1 cut(s) 237
TscAI CASTG 1 cut(s) 290
TseFI GTSAC 1 cut(s) 74
Tsp45I GTSAC 1 cut(s) 74
TspDTI ATGAA 3 cut(s) 27, 69, 243
TspRI CASTG 1 cut(s) 290
Vha464I CTTAAG 1 cut(s) 236
VneI GTGCAC 1 cut(s) 106
VpaK11BI GGWCC 1 cut(s) 244
XapI RAATTY 1 cut(s) 120
XceI RCATGY 1 cut(s) 32
XhoI CTCGAG 1 cut(s) 97
XspI CTAG 1 cut(s) 339
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.