Rh2CG354700

F-box LRR-repeat protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Reverse (-)
48020883 .. 48021290
408 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG354700.1

Sequence Viewer

Length: 408 bp
ATGGGTGTACACACCAAAAAGAAATCTGGGATATTTTCATCGTTGAGCGACGATTTACTTGGCCTAGTCATTAACAAGGTTAAGGACAAAGAAGATAGAAACTCGTTACCTCGGAACTGCAAGCAATGGTTTAAATTGAAAGGTCTAGACCGGTCATCACTTTCCCTTGATGTTAACAAGCCCGGATTTTCCCTTCCTGCACTAACTAGATTCCCCAATATAGTCAATTTGACATTATGGGATTTCAAGACCCACACCGACCTCGAATTCATAGCCAAAGCATGTCCTAAAATTGAGAGCATCATGATTGAATGCAGAGATGAGAAGCCAAAAGGTGATGGTTGTATTTTAAGCCGAAAAGGTCTCTGTGCTTTGGGAGATGGGTGTCCCAAATTGTCCGAAGTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

135

Amino Acids

15.02

Weight (kDa)

9.07

Isoelectric Point (pI)

42.8

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
F-box_5 PF18511 14 - 51 2.6e-06 F-box
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 266
AfaI GTAC 1 cut(s) 9
AgeI ACCGGT 1 cut(s) 150
AgsI TTSAA 3 cut(s) 139, 247, 311
Alw26I GTCTC 1 cut(s) 368
AoxI GGCC 1 cut(s) 61
ApoI RAATTY 1 cut(s) 266
AsiGI ACCGGT 1 cut(s) 150
AsuC2I CCSGG 1 cut(s) 183
AsuHPI GGTGA 1 cut(s) 347
BccI CCATC 2 cut(s) 332, 374
BcnI CCSGG 1 cut(s) 183
BcoDI GTCTC 1 cut(s) 368
BfaI CTAG 3 cut(s) 65, 146, 207
Bme1390I CCNGG 1 cut(s) 183
BmrFI CCNGG 1 cut(s) 183
BmsI GCATC 1 cut(s) 309
BpuMI CCSGG 1 cut(s) 183
BsaI GGTCTC 1 cut(s) 368
BsaJI CCNNGG 1 cut(s) 110
BsaWI WCCGGW 1 cut(s) 150
Bse118I RCCGGY 1 cut(s) 150
Bse3DI GCAATG 1 cut(s) 131
BseDI CCNNGG 1 cut(s) 110
BseMI GCAATG 1 cut(s) 131
BsgI GTGCAG 1 cut(s) 183
BshFI GGCC 1 cut(s) 63
BshTI ACCGGT 1 cut(s) 150
BsiSI CCGG 2 cut(s) 151, 183
BslFI GGGAC 1 cut(s) 372
BsmAI GTCTC 1 cut(s) 368
BsmFI GGGAC 1 cut(s) 372
BsmI GAATGC 1 cut(s) 317
BsnI GGCC 1 cut(s) 63
Bso31I GGTCTC 1 cut(s) 368
Bsp1407I TGTACA 1 cut(s) 7
BspANI GGCC 1 cut(s) 63
BspHI TCATGA 1 cut(s) 303
BspTNI GGTCTC 1 cut(s) 368
BsrDI GCAATG 1 cut(s) 131
BsrFI RCCGGY 1 cut(s) 150
BsrGI TGTACA 1 cut(s) 7
BssAI RCCGGY 1 cut(s) 150
BssECI CCNNGG 1 cut(s) 110
BstAUI TGTACA 1 cut(s) 7
BstC8I GCNNGC 1 cut(s) 122
BstMAI GTCTC 1 cut(s) 368
BstNSI RCATGY 1 cut(s) 285
BstSCI CCNGG 1 cut(s) 181
BsuRI GGCC 1 cut(s) 63
Cac8I GCNNGC 1 cut(s) 122
CciI TCATGA 1 cut(s) 303
Cfr10I RCCGGY 1 cut(s) 150
Csp6I GTAC 1 cut(s) 8
CspAI ACCGGT 1 cut(s) 150
CviAII CATG 2 cut(s) 282, 304
CviJI RGCY 5 cut(s) 63, 181, 275, 328, 354
CviKI_1 RGCY 5 cut(s) 63, 181, 275, 328, 354
CviQI GTAC 1 cut(s) 8
DraI TTTAAA 1 cut(s) 133
Eco31I GGTCTC 1 cut(s) 368
EcoRI GAATTC 1 cut(s) 266
FaeI CATG 2 cut(s) 285, 307
FaiI YATR 5 cut(s) 221, 238, 272, 283, 305
FaqI GGGAC 1 cut(s) 372
FatI CATG 2 cut(s) 281, 303
FspBI CTAG 3 cut(s) 65, 146, 207
HaeIII GGCC 1 cut(s) 63
HapII CCGG 2 cut(s) 151, 183
Hin1II CATG 2 cut(s) 285, 307
HincII GTYRAC 1 cut(s) 175
HindII GTYRAC 1 cut(s) 175
HinfI GANTC 1 cut(s) 210
HpaI GTTAAC 1 cut(s) 175
HpaII CCGG 2 cut(s) 151, 183
HphI GGTGA 1 cut(s) 347
Hpy166II GTNNAC 3 cut(s) 8, 10, 175
Hpy188I TCNGA 2 cut(s) 114, 400
Hpy188III TCNNGA 3 cut(s) 146, 247, 304
Hpy8I GTNNAC 3 cut(s) 8, 10, 175
Hpy99I CGWCG 1 cut(s) 53
HpyAV CCTTC 1 cut(s) 203
HpyCH4V TGCA 3 cut(s) 120, 200, 315
Hsp92II CATG 2 cut(s) 285, 307
KspAI GTTAAC 1 cut(s) 175
LpnPI CCDG 4 cut(s) 12, 164, 196, 210
LweI GCATC 1 cut(s) 309
MaeI CTAG 3 cut(s) 65, 146, 207
MaeIII GTNAC 1 cut(s) 105
MboII GAAGA 1 cut(s) 104
MluCI AATT 5 cut(s) 134, 226, 266, 291, 392
MnlI CCTC 2 cut(s) 120, 272
MseI TTAA 5 cut(s) 72, 81, 132, 174, 350
MspI CCGG 2 cut(s) 151, 183
MspR9I CCNGG 1 cut(s) 183
Mva1269I GAATGC 1 cut(s) 317
NciI CCSGG 1 cut(s) 183
NlaIII CATG 2 cut(s) 285, 307
NspI RCATGY 1 cut(s) 285
PagI TCATGA 1 cut(s) 303
PctI GAATGC 1 cut(s) 317
PfeI GAWTC 1 cut(s) 210
PinAI ACCGGT 1 cut(s) 150
RsaI GTAC 1 cut(s) 9
RsaNI GTAC 1 cut(s) 8
SaqAI TTAA 5 cut(s) 72, 81, 132, 174, 350
ScrFI CCNGG 1 cut(s) 183
SetI ASST 6 cut(s) 81, 112, 145, 264, 337, 364
SfaNI GCATC 1 cut(s) 309
Sse9I AATT 5 cut(s) 134, 226, 266, 291, 392
SspMI CTAG 3 cut(s) 65, 146, 207
StyD4I CCNGG 1 cut(s) 181
TaqI TCGA 1 cut(s) 264
TasI AATT 5 cut(s) 134, 226, 266, 291, 392
TatI WGTACW 1 cut(s) 7
TfiI GAWTC 1 cut(s) 210
Tru1I TTAA 5 cut(s) 72, 81, 132, 174, 350
Tru9I TTAA 5 cut(s) 72, 81, 132, 174, 350
TspDTI ATGAA 2 cut(s) 27, 259
XapI RAATTY 1 cut(s) 266
XbaI TCTAGA 1 cut(s) 145
XceI RCATGY 1 cut(s) 285
XspI CTAG 3 cut(s) 65, 146, 207
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.