Rmu_sc0023242.1_g000006

F-box LRR-repeat protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0023242.1
Physical Location & Seq
Forward (+)
23587 .. 24666
1080 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0023242.1_g000006.1.cds

Sequence Viewer

Length: 1080 bp
atgagcgatgattttgttggtctaatcattagcaaggttagcatcaaagatgatagaaaatcgttctctgaggtctgcaagcaatggtttaaagtggaaggtctaagccgatcatcacttcgcgttttcgctgaccgacctggcttttccctggctgcactcactagattcccaaatctagttcatctggaaatatttgagcttcagacggacatcgaaatagaaatcatagcccagacatgccgcaaaatagagagcatcacggttttctgctttgatgcgcatcaggaaggtcatggtggtattttgaggggaaaaggactaatggctttgggaaatggatgtcccaaattgtccaaagttatgcttgctggggaagacacggtccgggattctggaattattgcacttctacattcaaaacatagctttgacgctttggttttcttatctaatagcttgatcacggatcaagccctcagagcaattggtttggcatcttcaattagcattttggagttggtaggttgttccggcatcaaggatatgggattggggtttttggcaaatgggtctacctcgaaaaccctcaagaaattggtcctaaatctttgccggggaatcactgatactggggtcaagcttttgcagaaaatgtgtagcttggagcacctggaattgtcctactgtgggaggagaggagaaatcactgatattggaggtgtggcaatctctgcaattcaaacgctcaaggaaataaaattggatggtcttctgggtgtatcagaccctaccatgcttgctcttgcccagaattgctgcaacttggaaatacttgatttagagggatgtcaaggtgtaactggagctggtattcgtgcattttcaagtcatcagtgcttgaaacgccttgtgttgctaggcttaaggaactttaatctctctgatgtggagagcgtagcgtttggatgcccctcattggagtcggaatctgttgtggtggattcactgtggaagctggatgcaacattgatgcaggacaacactagaagagtcctcaaattcactgaaatgtcgtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

359

Amino Acids

38.94

Weight (kDa)

6.19

Isoelectric Point (pI)

32.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 282
AccI GTMKAC 1 cut(s) 575
AccII CGCG 1 cut(s) 123
AciI CCGC 1 cut(s) 244
AclWI GGATC 1 cut(s) 477
AcsI RAATTY 1 cut(s) 1061
AcuI CTGAAG 1 cut(s) 188
AfiI CCNNNNNNNGG 2 cut(s) 690, 979
AflII CTTAAG 1 cut(s) 925
AgsI TTSAA 5 cut(s) 420, 504, 743, 888, 904
AjnI CCWGG 3 cut(s) 139, 150, 672
AluBI AGCT 7 cut(s) 202, 429, 459, 643, 663, 869, 1018
AluI AGCT 7 cut(s) 202, 429, 459, 643, 663, 869, 1018
Alw21I GWGCWC 1 cut(s) 672
AlwI GGATC 1 cut(s) 477
ApeKI GCWGC 2 cut(s) 155, 819
ApoI RAATTY 1 cut(s) 1061
AspLEI GCGC 1 cut(s) 283
AspS9I GGNCC 2 cut(s) 385, 601
AsuC2I CCSGG 2 cut(s) 389, 617
AvaII GGWCC 2 cut(s) 385, 601
BaeI ACNNNNGTAYC 2 cut(s) 621, 654
BbsI GAAGAC 2 cut(s) 384, 764
Bbv12I GWGCWC 1 cut(s) 672
BbvI GCAGC 2 cut(s) 142, 806
BccI CCATC 1 cut(s) 761
BciT130I CCWGG 3 cut(s) 141, 152, 674
BclI TGATCA 1 cut(s) 462
BcnI CCSGG 2 cut(s) 389, 617
BfaI CTAG 4 cut(s) 165, 179, 920, 1047
BfrI CTTAAG 1 cut(s) 925
BisI GCNGC 3 cut(s) 156, 244, 820
BlsI GCNGC 3 cut(s) 157, 245, 821
Bme1390I CCNGG 5 cut(s) 141, 152, 389, 617, 674
Bme18I GGWCC 2 cut(s) 385, 601
BmgT120I GGNCC 2 cut(s) 385, 601
BmrFI CCNGG 5 cut(s) 141, 152, 389, 617, 674
BmrI ACTGGG 1 cut(s) 642
BmsI GCATC 9 cut(s) 51, 267, 268, 292, 506, 546, 959, 1012, 1023
BmuI ACTGGG 1 cut(s) 642
BpiI GAAGAC 2 cut(s) 384, 764
BpmI CTGGAG 1 cut(s) 885
BpuEI CTTGAG 2 cut(s) 575, 734
BpuMI CCSGG 2 cut(s) 389, 617
BsaBI GATNNNNATC 1 cut(s) 282
BsaJI CCNNGG 2 cut(s) 150, 616
Bsc4I CCNNNNNNNGG 2 cut(s) 690, 979
Bse1I ACTGG 2 cut(s) 637, 868
Bse3DI GCAATG 1 cut(s) 89
Bse8I GATNNNNATC 1 cut(s) 282
BseBI CCWGG 3 cut(s) 141, 152, 674
BseDI CCNNGG 2 cut(s) 150, 616
BseGI GGATG 5 cut(s) 347, 772, 854, 974, 1027
BseJI GATNNNNATC 1 cut(s) 282
BseLI CCNNNNNNNGG 2 cut(s) 690, 979
BseMI GCAATG 1 cut(s) 89
BseMII CTCAG 2 cut(s) 60, 493
BseNI ACTGG 2 cut(s) 637, 868
BseRI GAGGAG 2 cut(s) 709, 714
BseXI GCAGC 2 cut(s) 142, 806
BseYI CCCAGC 1 cut(s) 371
BsgI GTGCAG 1 cut(s) 141
Bsh1236I CGCG 1 cut(s) 123
BsiHKAI GWGCWC 1 cut(s) 672
BsiSI CCGG 3 cut(s) 388, 534, 616
BslFI GGGAC 1 cut(s) 330
BslI CCNNNNNNNGG 2 cut(s) 690, 979
BsmFI GGGAC 1 cut(s) 330
Bsp1286I GDGCHC 1 cut(s) 672
Bsp143I GATC 3 cut(s) 110, 462, 469
BspACI CCGC 1 cut(s) 244
BspCNI CTCAG 2 cut(s) 61, 492
BspFNI CGCG 1 cut(s) 123
BspPI GGATC 1 cut(s) 477
BspTI CTTAAG 1 cut(s) 925
BsrDI GCAATG 1 cut(s) 89
BsrI ACTGG 2 cut(s) 637, 868
BssECI CCNNGG 2 cut(s) 150, 616
BssMI GATC 3 cut(s) 110, 462, 469
Bst2UI CCWGG 3 cut(s) 141, 152, 674
Bst4CI ACNGT 4 cut(s) 265, 385, 689, 1011
Bst6I CTCTTC 1 cut(s) 1045
BstAFI CTTAAG 1 cut(s) 925
BstAPI GCANNNNNTGC 1 cut(s) 734
BstC8I GCNNGC 3 cut(s) 80, 369, 801
BstDEI CTNAG 3 cut(s) 69, 104, 479
BstF5I GGATG 5 cut(s) 347, 772, 854, 974, 1027
BstFNI CGCG 1 cut(s) 123
BstHHI GCGC 1 cut(s) 283
BstKTI GATC 3 cut(s) 113, 465, 472
BstMBI GATC 3 cut(s) 110, 462, 469
BstMWI GCNNNNNNNGC 4 cut(s) 39, 482, 734, 906
BstNI CCWGG 3 cut(s) 141, 152, 674
BstNSI RCATGY 1 cut(s) 243
BstSCI CCNGG 5 cut(s) 139, 150, 387, 615, 672
BstUI CGCG 1 cut(s) 123
BstV1I GCAGC 2 cut(s) 142, 806
BstV2I GAAGAC 2 cut(s) 384, 764
BtgZI GCGATG 1 cut(s) 21
BtsCI GGATG 5 cut(s) 347, 772, 854, 974, 1027
BtsIMutI CAGTG 5 cut(s) 624, 708, 902, 1007, 1065
Cac8I GCNNGC 3 cut(s) 80, 369, 801
CfoI GCGC 1 cut(s) 283
Cfr13I GGNCC 2 cut(s) 385, 601
CpoI CGGWCCG 1 cut(s) 385
CseI GACGC 1 cut(s) 443
CspI CGGWCCG 1 cut(s) 385
CviAII CATG 3 cut(s) 240, 296, 796
DdeI CTNAG 3 cut(s) 69, 104, 479
DpnI GATC 3 cut(s) 112, 464, 471
DpnII GATC 3 cut(s) 110, 462, 469
DraI TTTAAA 1 cut(s) 91
Eam1104I CTCTTC 1 cut(s) 1045
EarI CTCTTC 1 cut(s) 1045
Eco47I GGWCC 2 cut(s) 385, 601
Eco57I CTGAAG 1 cut(s) 188
EcoRII CCWGG 3 cut(s) 139, 150, 672
FaeI CATG 3 cut(s) 243, 299, 799
FaiI YATR 7 cut(s) 230, 241, 297, 365, 426, 548, 797
FalI AAGNNNNNCTT 2 cut(s) 351, 383
FaqI GGGAC 1 cut(s) 330
FatI CATG 3 cut(s) 239, 295, 795
FbaI TGATCA 1 cut(s) 462
FblI GTMKAC 1 cut(s) 575
Fnu4HI GCNGC 3 cut(s) 156, 244, 820
FokI GGATG 5 cut(s) 354, 779, 861, 981, 1034
Fsp4HI GCNGC 3 cut(s) 156, 244, 820
FspAI RTGCGCAY 1 cut(s) 282
FspBI CTAG 4 cut(s) 165, 179, 920, 1047
FspI TGCGCA 1 cut(s) 282
GlaI GCGC 1 cut(s) 282
GluI GCNGC 3 cut(s) 156, 244, 820
GsaI CCCAGC 1 cut(s) 375
GsuI CTGGAG 1 cut(s) 885
HapII CCGG 3 cut(s) 388, 534, 616
HgaI GACGC 1 cut(s) 443
HhaI GCGC 1 cut(s) 283
Hin1II CATG 3 cut(s) 243, 299, 799
Hin6I GCGC 1 cut(s) 281
HinP1I GCGC 1 cut(s) 281
HindIII AAGCTT 1 cut(s) 641
HinfI GANTC 7 cut(s) 168, 392, 621, 983, 989, 1004, 1053
HpaII CCGG 3 cut(s) 388, 534, 616
Hpy166II GTNNAC 1 cut(s) 576
Hpy188I TCNGA 6 cut(s) 70, 207, 482, 787, 946, 988
Hpy188III TCNNGA 4 cut(s) 188, 287, 396, 592
Hpy8I GTNNAC 1 cut(s) 576
HpyAV CCTTC 2 cut(s) 92, 284
HpyCH4III ACNGT 4 cut(s) 265, 385, 689, 1011
HpyCH4V TGCA 9 cut(s) 78, 158, 407, 649, 737, 822, 881, 1025, 1036
HpyF10VI GCNNNNNNNGC 4 cut(s) 39, 482, 734, 906
HpyF3I CTNAG 3 cut(s) 69, 104, 479
Hsp92II CATG 3 cut(s) 243, 299, 799
HspAI GCGC 1 cut(s) 281
Ksp22I TGATCA 1 cut(s) 462
Kzo9I GATC 3 cut(s) 110, 462, 469
LmnI GCTCC 2 cut(s) 667, 866
Lsp1109I GCAGC 2 cut(s) 142, 806
LweI GCATC 9 cut(s) 51, 267, 268, 292, 506, 546, 959, 1012, 1023
MaeI CTAG 4 cut(s) 165, 179, 920, 1047
MaeIII GTNAC 1 cut(s) 859
MalI GATC 3 cut(s) 112, 464, 471
MboI GATC 3 cut(s) 110, 462, 469
MboII GAAGA 4 cut(s) 389, 492, 764, 1062
MfeI CAATTG 1 cut(s) 486
MhlI GDGCHC 1 cut(s) 672
MlyI GAGTC 2 cut(s) 992, 1062
MmeI TCCRAC 1 cut(s) 966
MseI TTAA 3 cut(s) 90, 926, 936
MslI CAYNNNNRTG 1 cut(s) 1070
MspCI CTTAAG 1 cut(s) 925
MspI CCGG 3 cut(s) 388, 534, 616
MspR9I CCNGG 5 cut(s) 141, 152, 389, 617, 674
MunI CAATTG 1 cut(s) 486
MvaI CCWGG 3 cut(s) 141, 152, 674
MvnI CGCG 1 cut(s) 123
MwoI GCNNNNNNNGC 4 cut(s) 39, 482, 734, 906
NciI CCSGG 2 cut(s) 389, 617
NdeII GATC 3 cut(s) 110, 462, 469
NlaIII CATG 3 cut(s) 243, 299, 799
NsbI TGCGCA 1 cut(s) 282
NspI RCATGY 1 cut(s) 243
PfeI GAWTC 5 cut(s) 168, 392, 621, 989, 1004
PflFI GACNNNGTC 1 cut(s) 383
PfoI TCCNGGA 1 cut(s) 387
PkrI GCNGC 3 cut(s) 157, 245, 821
PleI GAGTC 2 cut(s) 991, 1061
PpsI GAGTC 2 cut(s) 991, 1061
Psp6I CCWGG 3 cut(s) 139, 150, 672
PspFI CCCAGC 1 cut(s) 371
PspGI CCWGG 3 cut(s) 139, 150, 672
PspPI GGNCC 2 cut(s) 385, 601
PsyI GACNNNGTC 1 cut(s) 383
RseI CAYNNNNRTG 1 cut(s) 1070
Rsr2I CGGWCCG 1 cut(s) 385
RsrII CGGWCCG 1 cut(s) 385
SaqAI TTAA 3 cut(s) 90, 926, 936
SatI GCNGC 3 cut(s) 156, 244, 820
Sau3AI GATC 3 cut(s) 110, 462, 469
Sau96I GGNCC 2 cut(s) 385, 601
SchI GAGTC 2 cut(s) 992, 1062
ScrFI CCNGG 5 cut(s) 141, 152, 389, 617, 674
SduI GDGCHC 1 cut(s) 672
SfaNI GCATC 9 cut(s) 51, 267, 268, 292, 506, 546, 959, 1012, 1023
SinI GGWCC 2 cut(s) 385, 601
SmiMI CAYNNNNRTG 1 cut(s) 1070
SmlI CTYRAG 3 cut(s) 590, 749, 925
SmoI CTYRAG 3 cut(s) 590, 749, 925
SsiI CCGC 1 cut(s) 244
SspI AATATT 1 cut(s) 195
SspMI CTAG 4 cut(s) 165, 179, 920, 1047
StyD4I CCNGG 5 cut(s) 139, 150, 387, 615, 672
TaaI ACNGT 4 cut(s) 265, 385, 689, 1011
TaqI TCGA 2 cut(s) 216, 581
TaqII GACCGA 1 cut(s) 150
TauI GCSGC 1 cut(s) 246
TfiI GAWTC 5 cut(s) 168, 392, 621, 989, 1004
Tru1I TTAA 3 cut(s) 90, 926, 936
Tru9I TTAA 3 cut(s) 90, 926, 936
TscAI CASTG 5 cut(s) 631, 715, 902, 1014, 1072
TseI GCWGC 2 cut(s) 155, 819
TspDTI ATGAA 1 cut(s) 173
TspGWI ACGGA 2 cut(s) 224, 482
TspRI CASTG 5 cut(s) 631, 715, 902, 1014, 1072
Tth111I GACNNNGTC 1 cut(s) 383
Vha464I CTTAAG 1 cut(s) 925
VpaK11BI GGWCC 2 cut(s) 385, 601
XapI RAATTY 1 cut(s) 1061
XceI RCATGY 1 cut(s) 243
XmiI GTMKAC 1 cut(s) 575
XspI CTAG 4 cut(s) 165, 179, 920, 1047
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.