Rmu_ssc0000226.1_g000027

F-box LRR-repeat protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000226.1
Physical Location & Seq
Forward (+)
96549 .. 97010
462 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000226.1_g000027.1.cds

Sequence Viewer

Length: 462 bp
atgtgctatatatggatatgccacagcctggagcacctggatttgtctaactgtgggagtagaatcactaatcttggaggtgtggcaatctttgcaattcaaaccctcacggaattgcaattggttgatcttcagaccgtgtcaaacagtaccatggttgctcttgcagagaactgccttaacttggaaatactttatttatgggactgtaaagctgtaacaggagctggcatttgtgcattttcaggtcataagtgtttgaaacgccttgtattgcttaacttaccctatcacaatttcgatgaaactgatttggacagcatagcccttggattcccgtcattggagtcggaatcagttctggtgaacgataggattgaattggtgcactacagaactagaagagtcgtcaagttcattgatatcttcatgcagtccttcagattgaatgagcagatgtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

153

Amino Acids

17.34

Weight (kDa)

5.23

Isoelectric Point (pI)

46.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 28
AcuI CTGAAG 2 cut(s) 116, 424
AfaI GTAC 1 cut(s) 151
AfiI CCNNNNNNNGG 3 cut(s) 28, 184, 343
AgsI TTSAA 4 cut(s) 101, 262, 380, 448
AjnI CCWGG 2 cut(s) 27, 36
AluBI AGCT 2 cut(s) 215, 227
AluI AGCT 2 cut(s) 215, 227
Alw21I GWGCWC 2 cut(s) 36, 390
Alw44I GTGCAC 1 cut(s) 386
AlwNI CAGNNNCTG 1 cut(s) 227
ApaLI GTGCAC 1 cut(s) 386
Asp700I GAANNNNTTC 1 cut(s) 357
AsuHPI GGTGA 1 cut(s) 376
BaeGI GKGCMC 1 cut(s) 390
Bbv12I GWGCWC 2 cut(s) 36, 390
BciT130I CCWGG 2 cut(s) 29, 38
BfaI CTAG 1 cut(s) 399
BfmI CTRYAG 1 cut(s) 391
Bme1390I CCNGG 2 cut(s) 29, 38
BmrFI CCNGG 2 cut(s) 29, 38
BpmI CTGGAG 1 cut(s) 50
BsaJI CCNNGG 2 cut(s) 153, 328
Bsc4I CCNNNNNNNGG 3 cut(s) 28, 184, 343
BseBI CCWGG 2 cut(s) 29, 38
BseDI CCNNGG 2 cut(s) 153, 328
BseLI CCNNNNNNNGG 3 cut(s) 28, 184, 343
BseSI GKGCMC 1 cut(s) 390
BsiHKAI GWGCWC 2 cut(s) 36, 390
BslFI GGGAC 1 cut(s) 218
BslI CCNNNNNNNGG 3 cut(s) 28, 184, 343
BsmFI GGGAC 1 cut(s) 218
Bsp1286I GDGCHC 2 cut(s) 36, 390
Bsp143I GATC 1 cut(s) 127
Bsp19I CCATGG 1 cut(s) 153
BssECI CCNNGG 2 cut(s) 153, 328
BssMI GATC 1 cut(s) 127
BssT1I CCWWGG 2 cut(s) 153, 328
Bst2UI CCWGG 2 cut(s) 29, 38
Bst4CI ACNGT 4 cut(s) 53, 139, 149, 209
Bst6I CTCTTC 1 cut(s) 397
BstAPI GCANNNNNTGC 1 cut(s) 92
BstC8I GCNNGC 1 cut(s) 229
BstDSI CCRYGG 1 cut(s) 153
BstKTI GATC 1 cut(s) 130
BstMBI GATC 1 cut(s) 127
BstMWI GCNNNNNNNGC 1 cut(s) 92
BstNI CCWGG 2 cut(s) 29, 38
BstSCI CCNGG 2 cut(s) 27, 36
BstSFI CTRYAG 1 cut(s) 391
BstSLI GKGCMC 1 cut(s) 390
BtgI CCRYGG 1 cut(s) 153
Cac8I GCNNGC 1 cut(s) 229
CaiI CAGNNNCTG 1 cut(s) 227
Csp6I GTAC 1 cut(s) 150
CviAII CATG 2 cut(s) 154, 430
CviJI RGCY 4 cut(s) 27, 215, 227, 326
CviKI_1 RGCY 4 cut(s) 27, 215, 227, 326
CviQI GTAC 1 cut(s) 150
DpnI GATC 1 cut(s) 129
DpnII GATC 1 cut(s) 127
Eam1104I CTCTTC 1 cut(s) 397
EarI CTCTTC 1 cut(s) 397
Eco130I CCWWGG 2 cut(s) 153, 328
Eco32I GATATC 1 cut(s) 424
Eco57I CTGAAG 2 cut(s) 116, 424
EcoRII CCWGG 2 cut(s) 27, 36
EcoRV GATATC 1 cut(s) 424
EcoT14I CCWWGG 2 cut(s) 153, 328
ErhI CCWWGG 2 cut(s) 153, 328
FaeI CATG 2 cut(s) 157, 433
FaiI YATR 9 cut(s) 9, 11, 13, 19, 155, 202, 252, 323, 431
FaqI GGGAC 1 cut(s) 218
FatI CATG 2 cut(s) 153, 429
FspBI CTAG 1 cut(s) 399
GsuI CTGGAG 1 cut(s) 50
Hin1II CATG 2 cut(s) 157, 433
HinfI GANTC 5 cut(s) 63, 333, 347, 353, 405
HphI GGTGA 1 cut(s) 376
Hpy166II GTNNAC 2 cut(s) 367, 388
Hpy188I TCNGA 3 cut(s) 135, 352, 443
Hpy8I GTNNAC 2 cut(s) 367, 388
HpyAV CCTTC 1 cut(s) 448
HpyCH4III ACNGT 4 cut(s) 53, 139, 149, 209
HpyCH4V TGCA 6 cut(s) 95, 118, 167, 239, 388, 433
HpyF10VI GCNNNNNNNGC 1 cut(s) 92
Hsp92II CATG 2 cut(s) 157, 433
Kzo9I GATC 1 cut(s) 127
LmnI GCTCC 2 cut(s) 31, 224
LpnPI CCDG 8 cut(s) 14, 23, 41, 50, 207, 213, 231, 347
MaeI CTAG 1 cut(s) 399
MaeIII GTNAC 1 cut(s) 217
MalI GATC 1 cut(s) 129
MboI GATC 1 cut(s) 127
MboII GAAGA 3 cut(s) 122, 414, 418
MfeI CAATTG 1 cut(s) 119
MhlI GDGCHC 2 cut(s) 36, 390
MluCI AATT 5 cut(s) 96, 113, 119, 295, 380
MlyI GAGTC 2 cut(s) 356, 414
MmeI TCCRAC 1 cut(s) 330
MnlI CCTC 2 cut(s) 71, 116
MroXI GAANNNNTTC 1 cut(s) 357
MseI TTAA 2 cut(s) 180, 279
MspR9I CCNGG 2 cut(s) 29, 38
MunI CAATTG 1 cut(s) 119
MvaI CCWGG 2 cut(s) 29, 38
MwoI GCNNNNNNNGC 1 cut(s) 92
NcoI CCATGG 1 cut(s) 153
NdeII GATC 1 cut(s) 127
NlaIII CATG 2 cut(s) 157, 433
PdmI GAANNNNTTC 1 cut(s) 357
PfeI GAWTC 3 cut(s) 63, 333, 353
PflFI GACNNNGTC 1 cut(s) 139
PflMI CCANNNNNTGG 1 cut(s) 28
PleI GAGTC 2 cut(s) 355, 413
PpsI GAGTC 2 cut(s) 355, 413
Psp6I CCWGG 2 cut(s) 27, 36
PspGI CCWGG 2 cut(s) 27, 36
PstNI CAGNNNCTG 1 cut(s) 227
PsyI GACNNNGTC 1 cut(s) 139
RsaI GTAC 1 cut(s) 151
RsaNI GTAC 1 cut(s) 150
SaqAI TTAA 2 cut(s) 180, 279
Sau3AI GATC 1 cut(s) 127
SchI GAGTC 2 cut(s) 356, 414
ScrFI CCNGG 2 cut(s) 29, 38
SduI GDGCHC 2 cut(s) 36, 390
SetI ASST 5 cut(s) 39, 82, 217, 229, 250
SfcI CTRYAG 1 cut(s) 391
Sse9I AATT 5 cut(s) 96, 113, 119, 295, 380
SspMI CTAG 1 cut(s) 399
StyD4I CCNGG 2 cut(s) 27, 36
StyI CCWWGG 2 cut(s) 153, 328
TaaI ACNGT 4 cut(s) 53, 139, 149, 209
TaqI TCGA 1 cut(s) 300
TasI AATT 5 cut(s) 96, 113, 119, 295, 380
TfiI GAWTC 3 cut(s) 63, 333, 353
Tru1I TTAA 2 cut(s) 180, 279
Tru9I TTAA 2 cut(s) 180, 279
TspDTI ATGAA 3 cut(s) 318, 406, 418
TspGWI ACGGA 1 cut(s) 125
Tth111I GACNNNGTC 1 cut(s) 139
Van91I CCANNNNNTGG 1 cut(s) 28
VneI GTGCAC 1 cut(s) 386
XmnI GAANNNNTTC 1 cut(s) 357
XspI CTAG 1 cut(s) 399
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.