Rmu_sc0001761.1_g000013

F-box LRR-repeat protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001761.1
Physical Location & Seq
Forward (+)
58367 .. 58783
417 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001761.1_g000013.1.cds

Sequence Viewer

Length: 342 bp
atgtgtagcttggagcacctgaaattgtcttatgagggagaagtcagtcaaatcactgatattggaggtgtgggaatttctgcaattagaaccctcagggaattgatattgaattatgtgaacctgtcggaccctaccatggccgctcttgcacagaattgccgcaacttggaaatgcttgatttaggggggttaaccaacttcagtctttctgatgtggaacagatagtgcctggatgcccatcattggattctgttgtggtggattcacataagaggtttgatccgacttggaagatgcacgacaaaactagaggagttattaagtgtccagtttcatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

113

Amino Acids

12.4

Weight (kDa)

5.2

Isoelectric Point (pI)

33.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 146
AciI CCGC 2 cut(s) 144, 163
AclWI GGATC 1 cut(s) 278
AcoI YGGCCR 1 cut(s) 141
AcsI RAATTY 1 cut(s) 75
AcuI CTGAAG 1 cut(s) 187
AfiI CCNNNNNNNGG 3 cut(s) 139, 169, 247
AgsI TTSAA 1 cut(s) 112
AjnI CCWGG 1 cut(s) 232
AluBI AGCT 1 cut(s) 9
AluI AGCT 1 cut(s) 9
Alw21I GWGCWC 1 cut(s) 18
AlwI GGATC 1 cut(s) 278
AoxI GGCC 1 cut(s) 141
ApoI RAATTY 1 cut(s) 75
AspS9I GGNCC 1 cut(s) 130
AvaII GGWCC 1 cut(s) 130
AxyI CCTNAGG 1 cut(s) 95
Bbv12I GWGCWC 1 cut(s) 18
BccI CCATC 1 cut(s) 250
BciT130I CCWGG 1 cut(s) 234
BfaI CTAG 1 cut(s) 312
BisI GCNGC 2 cut(s) 144, 163
BlsI GCNGC 2 cut(s) 145, 164
Bme1390I CCNGG 1 cut(s) 234
Bme18I GGWCC 1 cut(s) 130
BmgT120I GGNCC 1 cut(s) 130
BmiI GGNNCC 1 cut(s) 132
BmrFI CCNGG 1 cut(s) 234
BmsI GCATC 2 cut(s) 227, 288
BsaBI GATNNNNATC 1 cut(s) 241
BsaJI CCNNGG 1 cut(s) 138
Bsc4I CCNNNNNNNGG 3 cut(s) 139, 169, 247
Bse1I ACTGG 1 cut(s) 332
Bse21I CCTNAGG 1 cut(s) 95
Bse8I GATNNNNATC 1 cut(s) 241
BseBI CCWGG 1 cut(s) 234
BseDI CCNNGG 1 cut(s) 138
BseGI GGATG 1 cut(s) 242
BseJI GATNNNNATC 1 cut(s) 241
BseLI CCNNNNNNNGG 3 cut(s) 139, 169, 247
BseMII CTCAG 1 cut(s) 109
BseNI ACTGG 1 cut(s) 332
BseRI GAGGAG 1 cut(s) 330
BshFI GGCC 1 cut(s) 143
BsiHKAI GWGCWC 1 cut(s) 18
BslI CCNNNNNNNGG 3 cut(s) 139, 169, 247
BsnI GGCC 1 cut(s) 143
Bsp1286I GDGCHC 1 cut(s) 18
Bsp143I GATC 1 cut(s) 283
Bsp19I CCATGG 1 cut(s) 138
BspACI CCGC 2 cut(s) 144, 163
BspANI GGCC 1 cut(s) 143
BspCNI CTCAG 1 cut(s) 108
BspHI TCATGA 1 cut(s) 338
BspLI GGNNCC 1 cut(s) 132
BspPI GGATC 1 cut(s) 278
BsrBI CCGCTC 1 cut(s) 146
BsrI ACTGG 1 cut(s) 332
BssECI CCNNGG 1 cut(s) 138
BssMI GATC 1 cut(s) 283
BssT1I CCWWGG 1 cut(s) 138
Bst2UI CCWGG 1 cut(s) 234
BstDEI CTNAG 1 cut(s) 95
BstDSI CCRYGG 1 cut(s) 138
BstF5I GGATG 1 cut(s) 242
BstKTI GATC 1 cut(s) 286
BstMBI GATC 1 cut(s) 283
BstMWI GCNNNNNNNGC 1 cut(s) 149
BstNI CCWGG 1 cut(s) 234
BstSCI CCNGG 1 cut(s) 232
Bsu36I CCTNAGG 1 cut(s) 95
BsuRI GGCC 1 cut(s) 143
BtgI CCRYGG 1 cut(s) 138
BtsCI GGATG 1 cut(s) 242
BtsIMutI CAGTG 1 cut(s) 54
CciI TCATGA 1 cut(s) 338
Cfr13I GGNCC 1 cut(s) 130
CviAII CATG 2 cut(s) 139, 339
CviJI RGCY 2 cut(s) 9, 143
CviKI_1 RGCY 2 cut(s) 9, 143
DdeI CTNAG 1 cut(s) 95
DpnI GATC 1 cut(s) 285
DpnII GATC 1 cut(s) 283
EaeI YGGCCR 1 cut(s) 141
Eco130I CCWWGG 1 cut(s) 138
Eco47I GGWCC 1 cut(s) 130
Eco57I CTGAAG 1 cut(s) 187
Eco81I CCTNAGG 1 cut(s) 95
EcoRII CCWGG 1 cut(s) 232
EcoT14I CCWWGG 1 cut(s) 138
ErhI CCWWGG 1 cut(s) 138
FaeI CATG 2 cut(s) 142, 342
FaiI YATR 5 cut(s) 33, 117, 140, 273, 340
FatI CATG 2 cut(s) 138, 338
Fnu4HI GCNGC 2 cut(s) 144, 163
FokI GGATG 1 cut(s) 249
Fsp4HI GCNGC 2 cut(s) 144, 163
FspBI CTAG 1 cut(s) 312
GluI GCNGC 2 cut(s) 144, 163
HaeIII GGCC 1 cut(s) 143
Hin1II CATG 2 cut(s) 142, 342
HincII GTYRAC 1 cut(s) 195
HindII GTYRAC 1 cut(s) 195
HinfI GANTC 2 cut(s) 251, 266
HpaI GTTAAC 1 cut(s) 195
Hpy166II GTNNAC 2 cut(s) 121, 195
Hpy188I TCNGA 3 cut(s) 130, 214, 288
Hpy188III TCNNGA 1 cut(s) 339
Hpy8I GTNNAC 2 cut(s) 121, 195
HpyCH4V TGCA 3 cut(s) 83, 152, 301
HpyF10VI GCNNNNNNNGC 1 cut(s) 149
HpyF3I CTNAG 1 cut(s) 95
Hsp92II CATG 2 cut(s) 142, 342
KspAI GTTAAC 1 cut(s) 195
Kzo9I GATC 1 cut(s) 283
LmnI GCTCC 1 cut(s) 13
LpnPI CCDG 5 cut(s) 32, 82, 137, 219, 246
LweI GCATC 2 cut(s) 227, 288
MaeI CTAG 1 cut(s) 312
MalI GATC 1 cut(s) 285
MbiI CCGCTC 1 cut(s) 146
MboI GATC 1 cut(s) 283
MboII GAAGA 1 cut(s) 307
MhlI GDGCHC 1 cut(s) 18
MluCI AATT 6 cut(s) 23, 75, 84, 101, 112, 157
MmeI TCCRAC 2 cut(s) 108, 311
MnlI CCTC 5 cut(s) 28, 59, 104, 270, 308
MseI TTAA 2 cut(s) 194, 324
MspR9I CCNGG 1 cut(s) 234
MvaI CCWGG 1 cut(s) 234
MwoI GCNNNNNNNGC 1 cut(s) 149
NcoI CCATGG 1 cut(s) 138
NdeII GATC 1 cut(s) 283
NlaIII CATG 2 cut(s) 142, 342
NlaIV GGNNCC 1 cut(s) 132
PagI TCATGA 1 cut(s) 338
PfeI GAWTC 2 cut(s) 251, 266
PkrI GCNGC 2 cut(s) 145, 164
Psp6I CCWGG 1 cut(s) 232
PspGI CCWGG 1 cut(s) 232
PspN4I GGNNCC 1 cut(s) 132
PspPI GGNCC 1 cut(s) 130
SaqAI TTAA 2 cut(s) 194, 324
SatI GCNGC 2 cut(s) 144, 163
Sau3AI GATC 1 cut(s) 283
Sau96I GGNCC 1 cut(s) 130
ScrFI CCNGG 1 cut(s) 234
SduI GDGCHC 1 cut(s) 18
SetI ASST 5 cut(s) 11, 21, 70, 126, 281
SfaNI GCATC 2 cut(s) 227, 288
SinI GGWCC 1 cut(s) 130
Sse9I AATT 6 cut(s) 23, 75, 84, 101, 112, 157
SsiI CCGC 2 cut(s) 144, 163
SspMI CTAG 1 cut(s) 312
StyD4I CCNGG 1 cut(s) 232
StyI CCWWGG 1 cut(s) 138
TasI AATT 6 cut(s) 23, 75, 84, 101, 112, 157
TauI GCSGC 2 cut(s) 146, 165
TfiI GAWTC 2 cut(s) 251, 266
Tru1I TTAA 2 cut(s) 194, 324
Tru9I TTAA 2 cut(s) 194, 324
TscAI CASTG 1 cut(s) 61
TspDTI ATGAA 1 cut(s) 327
TspRI CASTG 1 cut(s) 61
VpaK11BI GGWCC 1 cut(s) 130
XapI RAATTY 1 cut(s) 75
XspI CTAG 1 cut(s) 312
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.