Rmu_sc0001722.1_g000001

tetratricopeptide repeat protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001722.1
OG0000877
Physical Location & Seq
Reverse (-)
1 .. 1779
1779 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001722.1_g000001.1.cds

Sequence Viewer

Length: 287 bp
atgatgatggaaacattggttcagggtatcaaggagccctctccaggagtggcagacaggattcctttctgctgtgggatttatatccctacagtttcagccttgcggaaggaatacggtgaactttgtgtccgctgtggtctgataggagaggcagtcaaaatttttgaggacttggaattatgggataatctgatattctgctatagcctattggagaaaaaagcagcagctgttgaactgatcaagacacggctttctgaaacacctaatgaccccaggttatg
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
TPR_16 TPR_2 TPR_8

Protein Analysis

95

Amino Acids

10.66

Weight (kDa)

4.93

Isoelectric Point (pI)

17.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 106, 133
AcsI RAATTY 1 cut(s) 162
AfiI CCNNNNNNNGG 1 cut(s) 44
AgsI TTSAA 1 cut(s) 239
AjnI CCWGG 2 cut(s) 43, 278
AloI GAACNNNNNNTCC 2 cut(s) 114, 146
AluBI AGCT 1 cut(s) 233
AluI AGCT 1 cut(s) 233
AlwNI CAGNNNCTG 1 cut(s) 233
ApeKI GCWGC 2 cut(s) 227, 230
ApoI RAATTY 1 cut(s) 162
AsuHPI GGTGA 1 cut(s) 131
BanII GRGCYC 1 cut(s) 39
BbvI GCAGC 2 cut(s) 239, 242
BceAI ACGGC 1 cut(s) 269
BciT130I CCWGG 2 cut(s) 45, 280
BclI TGATCA 1 cut(s) 243
BfmI CTRYAG 2 cut(s) 90, 205
BisI GCNGC 2 cut(s) 228, 231
BlsI GCNGC 2 cut(s) 229, 232
Bme1390I CCNGG 2 cut(s) 45, 280
BmiI GGNNCC 1 cut(s) 36
BmrFI CCNGG 2 cut(s) 45, 280
BpmI CTGGAG 1 cut(s) 27
BsaBI GATNNNNATC 1 cut(s) 83
BsaJI CCNNGG 1 cut(s) 278
BsaXI ACNNNNNCTCC 2 cut(s) 141, 171
Bsc4I CCNNNNNNNGG 1 cut(s) 44
Bse8I GATNNNNATC 1 cut(s) 83
BseBI CCWGG 2 cut(s) 45, 280
BseDI CCNNGG 1 cut(s) 278
BseJI GATNNNNATC 1 cut(s) 83
BseLI CCNNNNNNNGG 1 cut(s) 44
BseXI GCAGC 2 cut(s) 239, 242
BslI CCNNNNNNNGG 1 cut(s) 44
Bsp1286I GDGCHC 1 cut(s) 39
Bsp143I GATC 1 cut(s) 243
BspACI CCGC 2 cut(s) 106, 133
BspLI GGNNCC 1 cut(s) 36
BssECI CCNNGG 1 cut(s) 278
BssMI GATC 1 cut(s) 243
Bst2UI CCWGG 2 cut(s) 45, 280
Bst4CI ACNGT 2 cut(s) 94, 119
BstKTI GATC 1 cut(s) 246
BstMBI GATC 1 cut(s) 243
BstNI CCWGG 2 cut(s) 45, 280
BstSCI CCNGG 2 cut(s) 43, 278
BstSFI CTRYAG 2 cut(s) 90, 205
BstV1I GCAGC 2 cut(s) 239, 242
CaiI CAGNNNCTG 1 cut(s) 233
CviJI RGCY 5 cut(s) 37, 101, 210, 233, 256
CviKI_1 RGCY 5 cut(s) 37, 101, 210, 233, 256
DpnI GATC 1 cut(s) 245
DpnII GATC 1 cut(s) 243
Eco24I GRGCYC 1 cut(s) 39
EcoRII CCWGG 2 cut(s) 43, 278
EcoT38I GRGCYC 1 cut(s) 39
FaiI YATR 4 cut(s) 84, 184, 207, 286
FbaI TGATCA 1 cut(s) 243
Fnu4HI GCNGC 2 cut(s) 228, 231
FriOI GRGCYC 1 cut(s) 39
Fsp4HI GCNGC 2 cut(s) 228, 231
GluI GCNGC 2 cut(s) 228, 231
GsuI CTGGAG 1 cut(s) 27
HinfI GANTC 1 cut(s) 61
HphI GGTGA 1 cut(s) 131
Hpy166II GTNNAC 1 cut(s) 122
Hpy188I TCNGA 3 cut(s) 144, 195, 262
Hpy188III TCNNGA 1 cut(s) 247
Hpy8I GTNNAC 1 cut(s) 122
HpyAV CCTTC 1 cut(s) 103
HpyCH4III ACNGT 2 cut(s) 94, 119
Ksp22I TGATCA 1 cut(s) 243
Kzo9I GATC 1 cut(s) 243
LmnI GCTCC 1 cut(s) 34
LpnPI CCDG 5 cut(s) 8, 30, 43, 57, 265
Lsp1109I GCAGC 2 cut(s) 239, 242
MalI GATC 1 cut(s) 245
MboI GATC 1 cut(s) 243
MhlI GDGCHC 1 cut(s) 39
MluCI AATT 2 cut(s) 162, 179
MnlI CCTC 3 cut(s) 49, 145, 163
MspA1I CMGCKG 2 cut(s) 135, 233
MspR9I CCNGG 2 cut(s) 45, 280
MvaI CCWGG 2 cut(s) 45, 280
NdeII GATC 1 cut(s) 243
NlaIV GGNNCC 1 cut(s) 36
PfeI GAWTC 1 cut(s) 61
PfoI TCCNGGA 1 cut(s) 43
PkrI GCNGC 2 cut(s) 229, 232
Psp6I CCWGG 2 cut(s) 43, 278
PspGI CCWGG 2 cut(s) 43, 278
PspN4I GGNNCC 1 cut(s) 36
PstNI CAGNNNCTG 1 cut(s) 233
PvuII CAGCTG 1 cut(s) 233
SatI GCNGC 2 cut(s) 228, 231
Sau3AI GATC 1 cut(s) 243
ScrFI CCNGG 2 cut(s) 45, 280
SduI GDGCHC 1 cut(s) 39
SetI ASST 3 cut(s) 235, 271, 284
SfcI CTRYAG 2 cut(s) 90, 205
SgeI CNNG 9 cut(s) 35, 43, 56, 57, 70, 115, 187, 259, 264
Sse9I AATT 2 cut(s) 162, 179
SsiI CCGC 2 cut(s) 106, 133
StyD4I CCNGG 2 cut(s) 43, 278
TaaI ACNGT 2 cut(s) 94, 119
TasI AATT 2 cut(s) 162, 179
TfiI GAWTC 1 cut(s) 61
TseI GCWGC 2 cut(s) 227, 230
XapI RAATTY 1 cut(s) 162
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.