Rorug01G0055500

tetratricopeptide repeat protein

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000001
Physical Location & Seq
Reverse (-)
9064420 .. 9067383
2964 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug01G0055500.1

Sequence Viewer

Length: 462 bp
ATGTATGAAAATGTCAACATTCATAACAGCAGCAGTAGTAGAGATTGGAAGTTGAATACGTTTTCCTTTATTCAAGGCAGCTTCAATTCAAATCAAAATCTCTTTTTTCTCTGGGTTCTCTTTCAAGTGATTGATTTGTTAGATCGTCTGTATTCTAGGATATTGTTTGTGTATTCTGCAGCTTTCTTCAAAGCTTTGCTTTTGCTTTTGGTTAGAGTTCTTTGCAAAGAAGTGCGTGCATTATTCTTCTGCCGCTGTTCCTGTGTACATTGTTTGGCGTTATCTCAGTCTCTTATTCCTATTCAGACCAAGCATTACCCATGTAACTACATTCATCATCTTGGCTGGAAGGTTGAAATACAAGAGGTTATCTTTTTGAAGTGGATTTCTTCTGGCTTACTTTTGATCACTGCCAATGGAAAAGATGAGTTTTGCAGGCAATGGAAATCTCGCTTTATATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

153

Amino Acids

18.08

Weight (kDa)

9.19

Isoelectric Point (pI)

36.79

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 253
AfaI GTAC 1 cut(s) 267
AgsI TTSAA 8 cut(s) 55, 74, 85, 90, 125, 190, 356, 379
AluBI AGCT 3 cut(s) 81, 182, 194
AluI AGCT 3 cut(s) 81, 182, 194
Alw26I GTCTC 1 cut(s) 294
ApeKI GCWGC 3 cut(s) 30, 78, 179
BbvI GCAGC 3 cut(s) 42, 90, 191
BclI TGATCA 1 cut(s) 405
BcoDI GTCTC 1 cut(s) 294
BfaI CTAG 1 cut(s) 156
BfmI CTRYAG 1 cut(s) 177
BisI GCNGC 4 cut(s) 31, 79, 180, 253
BlsI GCNGC 4 cut(s) 32, 80, 181, 254
Bse3DI GCAATG 1 cut(s) 446
BseMI GCAATG 1 cut(s) 446
BseMII CTCAG 1 cut(s) 299
BseXI GCAGC 3 cut(s) 42, 90, 191
BsmAI GTCTC 1 cut(s) 294
Bsp1407I TGTACA 1 cut(s) 265
Bsp143I GATC 2 cut(s) 142, 405
BspACI CCGC 1 cut(s) 253
BspCNI CTCAG 1 cut(s) 298
BspMAI CTGCAG 1 cut(s) 181
BsrDI GCAATG 1 cut(s) 446
BsrGI TGTACA 1 cut(s) 265
BssMI GATC 2 cut(s) 142, 405
BstAUI TGTACA 1 cut(s) 265
BstC8I GCNNGC 2 cut(s) 237, 437
BstDEI CTNAG 1 cut(s) 285
BstKTI GATC 2 cut(s) 145, 408
BstMAI GTCTC 1 cut(s) 294
BstMBI GATC 2 cut(s) 142, 405
BstSFI CTRYAG 1 cut(s) 177
BstV1I GCAGC 3 cut(s) 42, 90, 191
BtsI GCAGTG 1 cut(s) 408
BtsIMutI CAGTG 1 cut(s) 408
Cac8I GCNNGC 2 cut(s) 237, 437
Csp6I GTAC 1 cut(s) 266
CviAII CATG 1 cut(s) 321
CviJI RGCY 5 cut(s) 81, 182, 194, 345, 396
CviKI_1 RGCY 5 cut(s) 81, 182, 194, 345, 396
CviQI GTAC 1 cut(s) 266
DdeI CTNAG 1 cut(s) 285
DpnI GATC 2 cut(s) 144, 407
DpnII GATC 2 cut(s) 142, 405
FaeI CATG 1 cut(s) 324
FaiI YATR 5 cut(s) 6, 24, 322, 458, 460
FalI AAGNNNNNCTT 2 cut(s) 183, 215
FatI CATG 1 cut(s) 320
FbaI TGATCA 1 cut(s) 405
Fnu4HI GCNGC 4 cut(s) 31, 79, 180, 253
Fsp4HI GCNGC 4 cut(s) 31, 79, 180, 253
FspBI CTAG 1 cut(s) 156
GluI GCNGC 4 cut(s) 31, 79, 180, 253
Hin1II CATG 1 cut(s) 324
HincII GTYRAC 1 cut(s) 16
HindII GTYRAC 1 cut(s) 16
HindIII AAGCTT 1 cut(s) 192
Hpy166II GTNNAC 2 cut(s) 16, 266
Hpy188I TCNGA 1 cut(s) 306
Hpy8I GTNNAC 2 cut(s) 16, 266
HpyAV CCTTC 1 cut(s) 343
HpyCH4IV ACGT 1 cut(s) 59
HpyCH4V TGCA 4 cut(s) 179, 225, 239, 435
HpyF3I CTNAG 1 cut(s) 285
HpySE526I ACGT 1 cut(s) 59
Hsp92II CATG 1 cut(s) 324
Ksp22I TGATCA 1 cut(s) 405
Kzo9I GATC 2 cut(s) 142, 405
LpnPI CCDG 5 cut(s) 97, 274, 331, 378, 421
Lsp1109I GCAGC 3 cut(s) 42, 90, 191
MaeI CTAG 1 cut(s) 156
MaeII ACGT 1 cut(s) 59
MaeIII GTNAC 1 cut(s) 323
MalI GATC 2 cut(s) 144, 407
MboI GATC 2 cut(s) 142, 405
MboII GAAGA 3 cut(s) 178, 238, 381
MluCI AATT 1 cut(s) 85
MnlI CCTC 1 cut(s) 358
MspA1I CMGCKG 1 cut(s) 255
NdeII GATC 2 cut(s) 142, 405
NlaIII CATG 1 cut(s) 324
PkrI GCNGC 4 cut(s) 32, 80, 181, 254
PstI CTGCAG 1 cut(s) 181
RsaI GTAC 1 cut(s) 267
RsaNI GTAC 1 cut(s) 266
SatI GCNGC 4 cut(s) 31, 79, 180, 253
Sau3AI GATC 2 cut(s) 142, 405
SetI ASST 6 cut(s) 62, 83, 184, 196, 354, 369
SfcI CTRYAG 1 cut(s) 177
Sse9I AATT 1 cut(s) 85
SsiI CCGC 1 cut(s) 253
SspMI CTAG 1 cut(s) 156
TaiI ACGT 1 cut(s) 62
TasI AATT 1 cut(s) 85
TatI WGTACW 1 cut(s) 265
TauI GCSGC 1 cut(s) 255
TscAI CASTG 1 cut(s) 415
TseI GCWGC 3 cut(s) 30, 78, 179
TspDTI ATGAA 3 cut(s) 11, 21, 323
TspRI CASTG 1 cut(s) 415
XspI CTAG 1 cut(s) 156
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.