Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002745.1

Orthogroup ID

OG0000877

Physical Location & Seq

Genomic Coordinates Forward (+)

3416 .. 4927

Gene Structure 1512 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002745.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 438 bp

atgtcctacgtattcggtgggagtcgagacgtagtcacaaaggaacgtgcattgatgatgatggaaacattggttcagggcatcaacgatccctctccaggagtggcagtcaggattcctttctgctatgggatttatatccctacagtttcagccttgcggaatgaatacggtgaactttgtgtccgctgtggtctgataggagaggcagtcaaaatttttgaggacttggaattatgggataatctaatattctgctatagcctattggagaaaaaagccgcagctgttgaactgatcaagacacggctttctgaaacacctaatgaccccaggttatggtgttcgttgggtgacgttactaatgatgatgcctgctttgaaaaagacctagaagtctcaaacgataggtcggctcgggctattgggctaaggtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

TPR_16 TPR_2 TPR_8

Protein Analysis

145

Amino Acids

16.2

Weight (kDa)

4.72

Isoelectric Point (pI)

27.0

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000877)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G17270 AT5G17270 AT5G37130
fragaria_vesca	FvH4_7g02460
malus_domestica	MD10G1031900.v1.1
prunus_persica	Prupe.2G030300_v2.0.a1 Prupe.2G030300_v2.0.a1 Prupe.2G030300_v2.0.a1 Prupe.2G030300_v2.0.a1 Prupe.2G030300_v2.0.a1
pyrus_communis	pycom10g02020
rosa_chinensis	RchiOBHm_Chr1g0319751 RchiOBHm_Chr1g0319761 RchiOBHm_Chr1g0319801 RchiOBHm_Chr1g0319811 RchiOBHm_Chr1g0319861 RchiOBHm_Chr1g0320041 RchiOBHm_Chr1g0320601 RchiOBHm_Chr1g0320761 RchiOBHm_Chr1g0320781 RchiOBHm_Chr1g0320901 RchiOBHm_Chr1g0320911 RchiOBHm_Chr1g0321111
rosa_laevigata	RLG00000030451 RLG00000030455 RLG00000030458
rosa_multiflora	Rmu_sc0001512.1_g000008 Rmu_sc0001722.1_g000001 Rmu_sc0002745.1_g000001 Rmu_sc0002745.1_g000003 Rmu_sc0003446.1_g000001 Rmu_sc0004660.1_g000001 Rmu_sc0004660.1_g000005 Rmu_sc0004820.1_g000017 Rmu_sc0004820.1_g000018 Rmu_sc0007977.1_g000013
rosa_roxburghii	Rroxscaffold_160G00433640 Rroxscaffold_160G00433720 Rroxscaffold_2G00104290 Rroxscaffold_4G00328090 Rroxscaffold_4G00328120
rosa_rugosa	Rorug01G0030000 Rorug01G0030900 Rorug01G0055500
rosa_samantha	Rh1AG042000 Rh1AG043000 Rh1BG039700 Rh1CG043000 Rh1CG044900 Rh1CG045000 Rh1CG045100 Rh1DG022800 Rh1DG026100 Rh1DG047800 Rh1DG048100 Rh1DG048200 Rh1DG048900 Rh1DG049000 Rh1DG049400 Rh1DG049500 Rh1DG049700
rosa_wichuraiana	Rw0G001090 Rw0G001120 Rw1G003620 Rw1G003650 Rw1G003770

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	395
AccB7I	CCANNNNNTGG	1 cut(s)	339
AciI	CCGC	3 cut(s)	160, 187, 282
AclWI	GGATC	1 cut(s)	83
AcsI	RAATTY	1 cut(s)	216
AfiI	CCNNNNNNNGG	2 cut(s)	98, 339
AgsI	TTSAA	2 cut(s)	293, 383
AjnI	CCWGG	2 cut(s)	97, 332
AloI	GAACNNNNNNTCC	2 cut(s)	168, 200
AluBI	AGCT	1 cut(s)	287
AluI	AGCT	1 cut(s)	287
Alw26I	GTCTC	2 cut(s)	21, 403
AlwI	GGATC	1 cut(s)	83
Ama87I	CYCGRG	1 cut(s)	417
ApeKI	GCWGC	1 cut(s)	284
ApoI	RAATTY	1 cut(s)	216
ArsI	GACNNNNNNTTYG	2 cut(s)	395, 427
AsuHPI	GGTGA	2 cut(s)	185, 365
AvaI	CYCGRG	1 cut(s)	417
BbvI	GCAGC	1 cut(s)	296
BccI	CCATC	1 cut(s)	55
BceAI	ACGGC	1 cut(s)	323
BciT130I	CCWGG	2 cut(s)	99, 334
BclI	TGATCA	1 cut(s)	297
BcoDI	GTCTC	2 cut(s)	21, 403
BfaI	CTAG	1 cut(s)	392
BfmI	CTRYAG	2 cut(s)	144, 259
BisI	GCNGC	2 cut(s)	282, 285
BlsI	GCNGC	2 cut(s)	283, 286
Bme1390I	CCNGG	2 cut(s)	99, 334
BmeT110I	CYCGRG	1 cut(s)	417
BmrFI	CCNGG	2 cut(s)	99, 334
BmsI	GCATC	2 cut(s)	90, 361
BpmI	CTGGAG	1 cut(s)	81
Bpu10I	CCTNAGC	1 cut(s)	431
BsaAI	YACGTR	1 cut(s)	10
BsaBI	GATNNNNATC	1 cut(s)	137
BsaJI	CCNNGG	1 cut(s)	332
BsaXI	ACNNNNNCTCC	4 cut(s)	93, 123, 195, 225
Bsc4I	CCNNNNNNNGG	2 cut(s)	98, 339
Bse8I	GATNNNNATC	1 cut(s)	137
BseBI	CCWGG	2 cut(s)	99, 334
BseDI	CCNNGG	1 cut(s)	332
BseJI	GATNNNNATC	1 cut(s)	137
BseLI	CCNNNNNNNGG	2 cut(s)	98, 339
BseXI	GCAGC	1 cut(s)	296
BsiHKCI	CYCGRG	1 cut(s)	417
BslI	CCNNNNNNNGG	2 cut(s)	98, 339
BsmAI	GTCTC	2 cut(s)	21, 403
BsmBI	CGTCTC	1 cut(s)	21
BsoBI	CYCGRG	1 cut(s)	417
Bsp143I	GATC	2 cut(s)	88, 297
BspACI	CCGC	3 cut(s)	160, 187, 282
BspPI	GGATC	1 cut(s)	83
BssECI	CCNNGG	1 cut(s)	332
BssMI	GATC	2 cut(s)	88, 297
Bst2UI	CCWGG	2 cut(s)	99, 334
Bst4CI	ACNGT	2 cut(s)	148, 173
BstBAI	YACGTR	1 cut(s)	10
BstC8I	GCNNGC	1 cut(s)	376
BstDEI	CTNAG	1 cut(s)	431
BstKTI	GATC	2 cut(s)	91, 300
BstMAI	GTCTC	2 cut(s)	21, 403
BstMBI	GATC	2 cut(s)	88, 297
BstNI	CCWGG	2 cut(s)	99, 334
BstSCI	CCNGG	2 cut(s)	97, 332
BstSFI	CTRYAG	2 cut(s)	144, 259
BstSNI	TACGTA	1 cut(s)	10
BstV1I	GCAGC	1 cut(s)	296
Cac8I	GCNNGC	1 cut(s)	376
CviJI	RGCY	8 cut(s)	155, 264, 281, 287, 310, 416, 422, 430
CviKI_1	RGCY	8 cut(s)	155, 264, 281, 287, 310, 416, 422, 430
DdeI	CTNAG	1 cut(s)	431
DpnI	GATC	2 cut(s)	90, 299
DpnII	GATC	2 cut(s)	88, 297
DrdI	GACNNNNNNGTC	1 cut(s)	395
DseDI	GACNNNNNNGTC	1 cut(s)	395
Eco105I	TACGTA	1 cut(s)	10
Eco88I	CYCGRG	1 cut(s)	417
EcoRII	CCWGG	2 cut(s)	97, 332
Esp3I	CGTCTC	1 cut(s)	21
FaiI	YATR	5 cut(s)	129, 138, 238, 261, 340
FbaI	TGATCA	1 cut(s)	297
Fnu4HI	GCNGC	2 cut(s)	282, 285
Fsp4HI	GCNGC	2 cut(s)	282, 285
FspBI	CTAG	1 cut(s)	392
GluI	GCNGC	2 cut(s)	282, 285
GsuI	CTGGAG	1 cut(s)	81
HinfI	GANTC	2 cut(s)	22, 115
HphI	GGTGA	2 cut(s)	185, 365
Hpy166II	GTNNAC	1 cut(s)	176
Hpy188I	TCNGA	2 cut(s)	198, 316
Hpy188III	TCNNGA	3 cut(s)	26, 112, 301
Hpy8I	GTNNAC	1 cut(s)	176
HpyCH4III	ACNGT	2 cut(s)	148, 173
HpyCH4IV	ACGT	4 cut(s)	9, 30, 46, 357
HpyCH4V	TGCA	1 cut(s)	50
HpyF3I	CTNAG	1 cut(s)	431
HpySE526I	ACGT	4 cut(s)	9, 30, 46, 357
Ksp22I	TGATCA	1 cut(s)	297
Kzo9I	GATC	2 cut(s)	88, 297
LpnPI	CCDG	7 cut(s)	62, 84, 97, 111, 319, 346, 388
Lsp1109I	GCAGC	1 cut(s)	296
LweI	GCATC	2 cut(s)	90, 361
MaeI	CTAG	1 cut(s)	392
MaeII	ACGT	4 cut(s)	9, 30, 46, 357
MaeIII	GTNAC	3 cut(s)	34, 353, 358
MalI	GATC	2 cut(s)	90, 299
MboI	GATC	2 cut(s)	88, 297
MluCI	AATT	2 cut(s)	216, 233
MlyI	GAGTC	1 cut(s)	31
MnlI	CCTC	3 cut(s)	103, 199, 217
MspA1I	CMGCKG	2 cut(s)	189, 287
MspR9I	CCNGG	2 cut(s)	99, 334
MvaI	CCWGG	2 cut(s)	99, 334
NdeII	GATC	2 cut(s)	88, 297
NmuCI	GTSAC	2 cut(s)	34, 353
PfeI	GAWTC	1 cut(s)	115
PflFI	GACNNNGTC	1 cut(s)	32
PflMI	CCANNNNNTGG	1 cut(s)	339
PfoI	TCCNGGA	1 cut(s)	97
PkrI	GCNGC	2 cut(s)	283, 286
PleI	GAGTC	1 cut(s)	30
PpsI	GAGTC	1 cut(s)	30
Ppu21I	YACGTR	1 cut(s)	10
Psp6I	CCWGG	2 cut(s)	97, 332
PspGI	CCWGG	2 cut(s)	97, 332
PsyI	GACNNNGTC	1 cut(s)	32
PvuII	CAGCTG	1 cut(s)	287
SatI	GCNGC	2 cut(s)	282, 285
Sau3AI	GATC	2 cut(s)	88, 297
SchI	GAGTC	1 cut(s)	31
ScrFI	CCNGG	2 cut(s)	99, 334
SfaNI	GCATC	2 cut(s)	90, 361
SfcI	CTRYAG	2 cut(s)	144, 259
SnaBI	TACGTA	1 cut(s)	10
Sse9I	AATT	2 cut(s)	216, 233
SsiI	CCGC	3 cut(s)	160, 187, 282
SspI	AATATT	1 cut(s)	252
SspMI	CTAG	1 cut(s)	392
StyD4I	CCNGG	2 cut(s)	97, 332
TaaI	ACNGT	2 cut(s)	148, 173
TaiI	ACGT	4 cut(s)	12, 33, 49, 360
TaqI	TCGA	1 cut(s)	25
TasI	AATT	2 cut(s)	216, 233
TauI	GCSGC	1 cut(s)	284
TfiI	GAWTC	1 cut(s)	115
TseFI	GTSAC	2 cut(s)	34, 353
TseI	GCWGC	1 cut(s)	284
Tsp45I	GTSAC	2 cut(s)	34, 353
TspDTI	ATGAA	1 cut(s)	180
Tth111I	GACNNNGTC	1 cut(s)	32
Van91I	CCANNNNNTGG	1 cut(s)	339
XapI	RAATTY	1 cut(s)	216
XspI	CTAG	1 cut(s)	392

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.