Rmu_sc0003611.1_g000014

F-box LRR-repeat protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003611.1
OG0000637
Physical Location & Seq
Forward (+)
38690 .. 39049
360 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003611.1_g000014.1.cds

Sequence Viewer

Length: 360 bp
atggatcaacgaagatgggaggacttagataaggactgtttggtgaaagtgtttgagaaagttgatatggagtcactactcttggatattccttttgtgtgcaagtcatggcacaaagaaacactaaatccttcttgctggaaaagtctaatctttccggaatttgaacctgaagttccttatgaatttgattatccaatctatgaaagatttgtttctgaatctggccttgataggaatcgtgtctccaaaactgcctttataaagtttgttgtcaatcgtagccaaggaaatgctgttgttctcaagctacctggatgctctaccgtagaagcctttgaatacgttgcagatgcgtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
F-box F-box-like

Protein Analysis

119

Amino Acids

13.92

Weight (kDa)

4.81

Isoelectric Point (pI)

47.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000637)

Species Orthologous Gene IDs
fragaria_vesca FvH4_4g13771 FvH4_4g13861 FvH4_4g13862 FvH4_4g13890 FvH4_4g13890 FvH4_4g13890 FvH4_4g13901
malus_domestica MD04G1010000.v1.1
prunus_persica Prupe.1G009600_v2.0.a1 Prupe.1G010100_v2.0.a1 Prupe.1G012400_v2.0.a1 Prupe.1G012700_v2.0.a1 Prupe.1G012700_v2.0.a1 Prupe.1G157400_v2.0.a1 Prupe.1G157500_v2.0.a1 Prupe.1G158200_v2.0.a1 Prupe.1G158200_v2.0.a1 Prupe.1G158200_v2.0.a1 Prupe.2G138900_v2.0.a1 Prupe.6G053000_v2.0.a1
pyrus_communis pycom04g00810
rosa_chinensis RchiOBHm_Chr4g0414621 RchiOBHm_Chr4g0414631 RchiOBHm_Chr4g0414641 RchiOBHm_Chr4g0415011 RchiOBHm_Chr4g0415031
rosa_laevigata RLG00000008101 RLG00000008104 RLG00000008138 RLG00000008139 RLG00000008140 RLG00000008354
rosa_multiflora Rmu_co8247483.1_g000001 Rmu_sc0003611.1_g000009 Rmu_sc0003611.1_g000014 Rmu_sc0007034.1_g000033 Rmu_sc0007391.1_g000006 Rmu_sc0011778.1_g000017 Rmu_sc0016172.1_g000002
rosa_roxburghii Rroxscaffold_5G00358400 Rroxscaffold_5G00358430 Rroxscaffold_5G00358610 Rroxscaffold_5G00358740 Rroxscaffold_5G00358750 Rroxscaffold_5G00358770
rosa_rugosa Rorug04G0108700 Rorug04G0128400 Rorug04G0128500 Rorug04G0128900 Rorug04G0129000 Rorug04G0129100 Rorug04G0131400 Rorug04G0131500 Rorug04G0131600 Rorug04G0131800 Rorug04G0131900
rosa_samantha Rh4AG187100 Rh4AG187200 Rh4AG190700 Rh4AG191200 Rh4BG185800 Rh4BG186100 Rh4BG188700 Rh4BG188900 Rh4BG189300 Rh4CG199200 Rh4CG199700 Rh4CG201900 Rh4CG202100 Rh4DG185400 Rh4DG185700 Rh4DG189300 Rh4DG189700 Rh6CG237600
rosa_wichuraiana Rw4G015970 Rw4G016000 Rw4G016240 Rw4G016260

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 263
AccIII TCCGGA 1 cut(s) 157
AclWI GGATC 1 cut(s) 12
AcsI RAATTY 2 cut(s) 161, 185
AcuI CTGAAG 1 cut(s) 192
AgsI TTSAA 2 cut(s) 167, 341
AjnI CCWGG 1 cut(s) 313
AluBI AGCT 1 cut(s) 310
AluI AGCT 1 cut(s) 310
Alw26I GTCTC 1 cut(s) 250
AlwI GGATC 1 cut(s) 12
Aor13HI TCCGGA 1 cut(s) 157
AoxI GGCC 1 cut(s) 226
ApoI RAATTY 2 cut(s) 161, 185
AsuHPI GGTGA 1 cut(s) 55
BccI CCATC 1 cut(s) 9
BciT130I CCWGG 1 cut(s) 315
BcoDI GTCTC 1 cut(s) 250
Bme1390I CCNGG 1 cut(s) 315
BmrFI CCNGG 1 cut(s) 315
BmsI GCATC 2 cut(s) 308, 343
BpuEI CTTGAG 1 cut(s) 290
BsaBI GATNNNNATC 1 cut(s) 237
BsaJI CCNNGG 1 cut(s) 286
BsaWI WCCGGW 1 cut(s) 157
Bse8I GATNNNNATC 1 cut(s) 237
BseAI TCCGGA 1 cut(s) 157
BseBI CCWGG 1 cut(s) 315
BseDI CCNNGG 1 cut(s) 286
BseGI GGATG 1 cut(s) 323
BseJI GATNNNNATC 1 cut(s) 237
BshFI GGCC 1 cut(s) 228
BsiSI CCGG 1 cut(s) 158
BsmAI GTCTC 1 cut(s) 250
BsnI GGCC 1 cut(s) 228
Bsp13I TCCGGA 1 cut(s) 157
Bsp143I GATC 1 cut(s) 4
BspANI GGCC 1 cut(s) 228
BspEI TCCGGA 1 cut(s) 157
BspPI GGATC 1 cut(s) 12
BssECI CCNNGG 1 cut(s) 286
BssMI GATC 1 cut(s) 4
BssT1I CCWWGG 1 cut(s) 286
Bst2UI CCWGG 1 cut(s) 315
Bst4CI ACNGT 2 cut(s) 38, 328
BstDEI CTNAG 1 cut(s) 25
BstF5I GGATG 1 cut(s) 323
BstKTI GATC 1 cut(s) 7
BstMAI GTCTC 1 cut(s) 250
BstMBI GATC 1 cut(s) 4
BstNI CCWGG 1 cut(s) 315
BstSCI CCNGG 1 cut(s) 313
BsuRI GGCC 1 cut(s) 228
BtsCI GGATG 1 cut(s) 323
CviAII CATG 1 cut(s) 108
CviJI RGCY 4 cut(s) 228, 285, 310, 335
CviKI_1 RGCY 4 cut(s) 228, 285, 310, 335
DdeI CTNAG 1 cut(s) 25
DpnI GATC 1 cut(s) 6
DpnII GATC 1 cut(s) 4
Eco130I CCWWGG 1 cut(s) 286
Eco57I CTGAAG 1 cut(s) 192
EcoRII CCWGG 1 cut(s) 313
EcoT14I CCWWGG 1 cut(s) 286
ErhI CCWWGG 1 cut(s) 286
FaeI CATG 1 cut(s) 111
FaiI YATR 5 cut(s) 68, 109, 183, 204, 263
FatI CATG 1 cut(s) 107
FokI GGATG 1 cut(s) 330
HaeIII GGCC 1 cut(s) 228
HapII CCGG 1 cut(s) 158
Hin1II CATG 1 cut(s) 111
HinfI GANTC 3 cut(s) 71, 221, 238
HpaII CCGG 1 cut(s) 158
HphI GGTGA 1 cut(s) 55
Hpy188I TCNGA 1 cut(s) 220
Hpy188III TCNNGA 1 cut(s) 158
HpyAV CCTTC 1 cut(s) 141
HpyCH4III ACNGT 2 cut(s) 38, 328
HpyCH4IV ACGT 1 cut(s) 345
HpyCH4V TGCA 2 cut(s) 102, 350
HpyF3I CTNAG 1 cut(s) 25
HpySE526I ACGT 1 cut(s) 345
Hsp92II CATG 1 cut(s) 111
Kpn2I TCCGGA 1 cut(s) 157
Kzo9I GATC 1 cut(s) 4
LpnPI CCDG 6 cut(s) 124, 171, 183, 210, 300, 327
LweI GCATC 2 cut(s) 308, 343
MaeII ACGT 1 cut(s) 345
MaeIII GTNAC 1 cut(s) 72
MalI GATC 1 cut(s) 6
MboI GATC 1 cut(s) 4
MboII GAAGA 1 cut(s) 24
MluCI AATT 2 cut(s) 161, 185
MlyI GAGTC 1 cut(s) 80
MnlI CCTC 1 cut(s) 13
MroI TCCGGA 1 cut(s) 157
MspI CCGG 1 cut(s) 158
MspR9I CCNGG 1 cut(s) 315
MvaI CCWGG 1 cut(s) 315
NdeII GATC 1 cut(s) 4
NlaIII CATG 1 cut(s) 111
NmuCI GTSAC 1 cut(s) 72
PfeI GAWTC 2 cut(s) 221, 238
PleI GAGTC 1 cut(s) 79
PpsI GAGTC 1 cut(s) 79
PsiI TTATAA 1 cut(s) 263
Psp6I CCWGG 1 cut(s) 313
PspGI CCWGG 1 cut(s) 313
Sau3AI GATC 1 cut(s) 4
SchI GAGTC 1 cut(s) 80
ScrFI CCNGG 1 cut(s) 315
SetI ASST 4 cut(s) 172, 312, 316, 348
SfaNI GCATC 2 cut(s) 308, 343
SmlI CTYRAG 1 cut(s) 305
SmoI CTYRAG 1 cut(s) 305
Sse9I AATT 2 cut(s) 161, 185
StyD4I CCNGG 1 cut(s) 313
StyI CCWWGG 1 cut(s) 286
TaaI ACNGT 2 cut(s) 38, 328
TaiI ACGT 1 cut(s) 348
TasI AATT 2 cut(s) 161, 185
TfiI GAWTC 2 cut(s) 221, 238
TseFI GTSAC 1 cut(s) 72
Tsp45I GTSAC 1 cut(s) 72
TspDTI ATGAA 2 cut(s) 198, 219
XapI RAATTY 2 cut(s) 161, 185
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.