Rmu_sc0020534.1_g000001
ERF Family

Phosphorylase superfamily

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0020534.1
OG0000829
Physical Location & Seq
Reverse (-)
15383 .. 18006
2624 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0020534.1_g000001.1.cds

Sequence Viewer

Length: 1074 bp
atgggggtagcttggccctgcgtagttgtttatgctgcgagcatcagcttgatgatgctcaacggagtagtgtgtgctgcactatctgaagaaacattggaattgatagccgaggccaacaagaatggcccttatttaggcttggtcattccaaattctttcgaaatggatcctctccttcaatctccgaacttcacttcctctaatttgactatagatttttctggaaggagatttcggtttggaacgattgctgaaaaaaaagtcatattagtcatgaccggacttgccatgattaatgcaggaataaccactcagctcttgctaagcttattcgatatagaaggggtggtgcattatggcatagctggctatgcaaacccaaatctccatcttgcagatgtggtcattcctcagtattgggcgcatactgctctttggaactggcagagatatggaaatggaccagaagatgagctaccccttgaatcacaaggagactacactagagacattggctacttaaaaattgcaaattatacagtcaatatgacagatagaagctcatacgacaacctgttgaacaatatctggtatcaaccggaggaagtcttccccgtcgatggaactccagaacaaagacagcacgccttttggatccctgttgatccattctactatgaagtttcccaaaagctagaggatgtgatattggaaggttgcctaaactcaacgacgtgtttgtcacatacaccaagagtggcaagagtccaaaggggaataagtgcaagcatttaccttgacaatgctgcatatcgcgacttcatatatgataagttcaacataactccggtggatatggaaagtgcttctgttgctttgatatgtcttcaacaaaaggtgcctttcattgtcattagagcgctctctgacttggccggtggtggctctgcagattcgaatgaggctgacactttcgtcactcttgcttccaacaattcagtcacagttcttttggaatttgtgaaacacttatctactgctactatctcattgagcaacatcaatgtttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PNP_UDP_1

Protein Analysis

357

Amino Acids

39.5

Weight (kDa)

4.59

Isoelectric Point (pI)

33.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 2 cut(s) 742, 977
AccB1I GGYRCC 1 cut(s) 901
AccII CGCG 1 cut(s) 819
AclWI GGATC 5 cut(s) 164, 177, 652, 662, 665
AcoI YGGCCR 1 cut(s) 936
AcsI RAATTY 2 cut(s) 154, 1019
AcuI CTGAAG 1 cut(s) 108
AfeI AGCGCT 1 cut(s) 924
AfiI CCNNNNNNNGG 2 cut(s) 137, 623
AflIII ACRYGT 1 cut(s) 737
AgsI TTSAA 5 cut(s) 182, 488, 583, 841, 893
AjiI CACGTC 1 cut(s) 738
AloI GAACNNNNNNTCC 2 cut(s) 182, 214
AluBI AGCT 8 cut(s) 11, 48, 319, 330, 368, 478, 564, 697
AluI AGCT 8 cut(s) 11, 48, 319, 330, 368, 478, 564, 697
Alw26I GTCTC 2 cut(s) 492, 504
AlwI GGATC 5 cut(s) 164, 177, 652, 662, 665
Aor51HI AGCGCT 1 cut(s) 924
AoxI GGCC 4 cut(s) 14, 114, 127, 936
ApeKI GCWGC 3 cut(s) 35, 77, 809
ApoI RAATTY 2 cut(s) 154, 1019
AseI ATTAAT 1 cut(s) 297
AspLEI GCGC 2 cut(s) 427, 925
AspS9I GGNCC 3 cut(s) 15, 128, 464
AsuII TTCGAA 2 cut(s) 162, 959
AvaII GGWCC 1 cut(s) 464
BamHI GGATCC 2 cut(s) 169, 657
BanI GGYRCC 1 cut(s) 901
BarI GAAGNNNNNNTAC 2 cut(s) 462, 494
BbsI GAAGAC 2 cut(s) 604, 881
BbvI GCAGC 3 cut(s) 22, 64, 796
BccI CCATC 2 cut(s) 399, 617
BcoDI GTCTC 2 cut(s) 492, 504
BfaI CTAG 2 cut(s) 507, 698
BfmI CTRYAG 2 cut(s) 213, 951
BfoI RGCGCY 1 cut(s) 926
BisI GCNGC 3 cut(s) 36, 78, 810
BlpI GCTNAGC 1 cut(s) 326
BlsI GCNGC 3 cut(s) 37, 79, 811
Bme18I GGWCC 1 cut(s) 464
BmgBI CACGTC 1 cut(s) 738
BmgT120I GGNCC 3 cut(s) 15, 128, 464
BmiI GGNNCC 3 cut(s) 171, 659, 903
BmsI GCATC 2 cut(s) 45, 51
BpiI GAAGAC 2 cut(s) 604, 881
BpmI CTGGAG 1 cut(s) 615
Bpu1102I GCTNAGC 1 cut(s) 326
Bpu14I TTCGAA 2 cut(s) 162, 959
BsaJI CCNNGG 1 cut(s) 111
BsaWI WCCGGW 3 cut(s) 281, 601, 850
Bsc4I CCNNNNNNNGG 2 cut(s) 137, 623
Bse118I RCCGGY 1 cut(s) 938
Bse1I ACTGG 1 cut(s) 449
BseDI CCNNGG 1 cut(s) 111
BseGI GGATG 1 cut(s) 709
BseLI CCNNNNNNNGG 2 cut(s) 137, 623
BseMII CTCAG 2 cut(s) 329, 428
BseNI ACTGG 1 cut(s) 449
BseXI GCAGC 3 cut(s) 22, 64, 796
BsgI GTGCAG 1 cut(s) 63
Bsh1236I CGCG 1 cut(s) 819
BshFI GGCC 4 cut(s) 16, 116, 129, 938
BshNI GGYRCC 1 cut(s) 901
BsiSI CCGG 4 cut(s) 282, 602, 851, 939
BslI CCNNNNNNNGG 2 cut(s) 137, 623
BsmAI GTCTC 2 cut(s) 492, 504
BsnI GGCC 4 cut(s) 16, 116, 129, 938
Bsp119I TTCGAA 2 cut(s) 162, 959
Bsp143I GATC 3 cut(s) 169, 657, 667
Bsp1720I GCTNAGC 1 cut(s) 326
Bsp68I TCGCGA 1 cut(s) 819
BspANI GGCC 4 cut(s) 16, 116, 129, 938
BspCNI CTCAG 2 cut(s) 328, 427
BspFNI CGCG 1 cut(s) 819
BspHI TCATGA 1 cut(s) 276
BspLI GGNNCC 3 cut(s) 171, 659, 903
BspMAI CTGCAG 1 cut(s) 955
BspPI GGATC 5 cut(s) 164, 177, 652, 662, 665
BspT104I TTCGAA 2 cut(s) 162, 959
BspT107I GGYRCC 1 cut(s) 901
BsrFI RCCGGY 1 cut(s) 938
BsrI ACTGG 1 cut(s) 449
BssAI RCCGGY 1 cut(s) 938
BssECI CCNNGG 1 cut(s) 111
BssMI GATC 3 cut(s) 169, 657, 667
Bst4CI ACNGT 2 cut(s) 544, 1009
BstBI TTCGAA 2 cut(s) 162, 959
BstC8I GCNNGC 4 cut(s) 40, 370, 648, 790
BstDEI CTNAG 3 cut(s) 315, 326, 414
BstENI CCTNNNNNAGG 1 cut(s) 135
BstF5I GGATG 1 cut(s) 709
BstFNI CGCG 1 cut(s) 819
BstH2I RGCGCY 1 cut(s) 926
BstHHI GCGC 2 cut(s) 427, 925
BstKTI GATC 3 cut(s) 172, 660, 670
BstMAI GTCTC 2 cut(s) 492, 504
BstMBI GATC 3 cut(s) 169, 657, 667
BstMWI GCNNNNNNNGC 4 cut(s) 369, 374, 431, 875
BstSFI CTRYAG 2 cut(s) 213, 951
BstUI CGCG 1 cut(s) 819
BstV1I GCAGC 3 cut(s) 22, 64, 796
BstV2I GAAGAC 2 cut(s) 604, 881
BstX2I RGATCY 2 cut(s) 169, 657
BstYI RGATCY 2 cut(s) 169, 657
BsuRI GGCC 4 cut(s) 16, 116, 129, 938
BtrI CACGTC 1 cut(s) 738
BtsCI GGATG 1 cut(s) 709
BtuMI TCGCGA 1 cut(s) 819
Cac8I GCNNGC 4 cut(s) 40, 370, 648, 790
CciI TCATGA 1 cut(s) 276
CfoI GCGC 2 cut(s) 427, 925
Cfr10I RCCGGY 1 cut(s) 938
Cfr13I GGNCC 3 cut(s) 15, 128, 464
CviAII CATG 2 cut(s) 277, 292
DdeI CTNAG 3 cut(s) 315, 326, 414
DpnI GATC 3 cut(s) 171, 659, 669
DpnII GATC 3 cut(s) 169, 657, 667
DrdI GACNNNNNNGTC 2 cut(s) 742, 977
DseDI GACNNNNNNGTC 2 cut(s) 742, 977
EaeI YGGCCR 1 cut(s) 936
Eco47I GGWCC 1 cut(s) 464
Eco47III AGCGCT 1 cut(s) 924
Eco57I CTGAAG 1 cut(s) 108
EcoNI CCTNNNNNAGG 1 cut(s) 135
FaeI CATG 2 cut(s) 280, 295
FatI CATG 2 cut(s) 276, 291
Fnu4HI GCNGC 3 cut(s) 36, 78, 810
FokI GGATG 1 cut(s) 716
Fsp4HI GCNGC 3 cut(s) 36, 78, 810
FspBI CTAG 2 cut(s) 507, 698
GlaI GCGC 2 cut(s) 426, 924
GluI GCNGC 3 cut(s) 36, 78, 810
GsuI CTGGAG 1 cut(s) 615
HaeII RGCGCY 1 cut(s) 926
HaeIII GGCC 4 cut(s) 16, 116, 129, 938
HapII CCGG 4 cut(s) 282, 602, 851, 939
HhaI GCGC 2 cut(s) 427, 925
Hin1II CATG 2 cut(s) 280, 295
Hin6I GCGC 2 cut(s) 425, 923
HinP1I GCGC 2 cut(s) 425, 923
HindIII AAGCTT 1 cut(s) 328
HinfI GANTC 3 cut(s) 488, 768, 956
HpaII CCGG 4 cut(s) 282, 602, 851, 939
Hpy188I TCNGA 3 cut(s) 88, 189, 931
Hpy188III TCNNGA 4 cut(s) 225, 277, 632, 818
Hpy99I CGWCG 2 cut(s) 623, 739
HpyAV CCTTC 4 cut(s) 188, 222, 338, 710
HpyCH4III ACNGT 2 cut(s) 544, 1009
HpyCH4IV ACGT 1 cut(s) 737
HpyCH4V TGCA 9 cut(s) 80, 302, 355, 377, 398, 533, 788, 812, 953
HpyF10VI GCNNNNNNNGC 4 cut(s) 369, 374, 431, 875
HpyF3I CTNAG 3 cut(s) 315, 326, 414
HpySE526I ACGT 1 cut(s) 737
Hsp92II CATG 2 cut(s) 280, 295
HspAI GCGC 2 cut(s) 425, 923
Kzo9I GATC 3 cut(s) 169, 657, 667
Lsp1109I GCAGC 3 cut(s) 22, 64, 796
LweI GCATC 2 cut(s) 45, 51
MaeI CTAG 2 cut(s) 507, 698
MaeII ACGT 1 cut(s) 737
MaeIII GTNAC 3 cut(s) 744, 979, 1003
MalI GATC 3 cut(s) 171, 659, 669
MboI GATC 3 cut(s) 169, 657, 667
MboII GAAGA 4 cut(s) 101, 482, 604, 881
MflI RGATCY 2 cut(s) 169, 657
MluCI AATT 7 cut(s) 101, 154, 205, 528, 535, 997, 1019
MlyI GAGTC 1 cut(s) 777
MmeI TCCRAC 1 cut(s) 1017
MnlI CCTC 7 cut(s) 106, 183, 211, 423, 598, 694, 958
MseI TTAA 3 cut(s) 297, 524, 1072
MspI CCGG 4 cut(s) 282, 602, 851, 939
MvnI CGCG 1 cut(s) 819
MwoI GCNNNNNNNGC 4 cut(s) 369, 374, 431, 875
NdeII GATC 3 cut(s) 169, 657, 667
NlaIII CATG 2 cut(s) 280, 295
NlaIV GGNNCC 3 cut(s) 171, 659, 903
NmeAIII GCCGAG 1 cut(s) 136
NmuCI GTSAC 3 cut(s) 744, 979, 1003
NruI TCGCGA 1 cut(s) 819
NspV TTCGAA 2 cut(s) 162, 959
PagI TCATGA 1 cut(s) 276
PfeI GAWTC 2 cut(s) 488, 956
PkrI GCNGC 3 cut(s) 37, 79, 811
PleI GAGTC 1 cut(s) 776
PpsI GAGTC 1 cut(s) 776
PshBI ATTAAT 1 cut(s) 297
PspN4I GGNNCC 3 cut(s) 171, 659, 903
PspPI GGNCC 3 cut(s) 15, 128, 464
PstI CTGCAG 1 cut(s) 955
PsuI RGATCY 2 cut(s) 169, 657
RruI TCGCGA 1 cut(s) 819
SaqAI TTAA 3 cut(s) 297, 524, 1072
SatI GCNGC 3 cut(s) 36, 78, 810
Sau3AI GATC 3 cut(s) 169, 657, 667
Sau96I GGNCC 3 cut(s) 15, 128, 464
SchI GAGTC 1 cut(s) 777
SfaNI GCATC 2 cut(s) 45, 51
SfcI CTRYAG 2 cut(s) 213, 951
SfuI TTCGAA 2 cut(s) 162, 959
SinI GGWCC 1 cut(s) 464
Sse9I AATT 7 cut(s) 101, 154, 205, 528, 535, 997, 1019
SspMI CTAG 2 cut(s) 507, 698
TaaI ACNGT 2 cut(s) 544, 1009
TaiI ACGT 1 cut(s) 740
TaqI TCGA 4 cut(s) 162, 336, 621, 959
TasI AATT 7 cut(s) 101, 154, 205, 528, 535, 997, 1019
TfiI GAWTC 2 cut(s) 488, 956
Tru1I TTAA 3 cut(s) 297, 524, 1072
Tru9I TTAA 3 cut(s) 297, 524, 1072
TseFI GTSAC 3 cut(s) 744, 979, 1003
TseI GCWGC 3 cut(s) 35, 77, 809
Tsp45I GTSAC 3 cut(s) 744, 979, 1003
TspDTI ATGAA 3 cut(s) 696, 814, 898
TspGWI ACGGA 1 cut(s) 78
VpaK11BI GGWCC 1 cut(s) 464
VspI ATTAAT 1 cut(s) 297
XagI CCTNNNNNAGG 1 cut(s) 135
XapI RAATTY 2 cut(s) 154, 1019
XspI CTAG 2 cut(s) 507, 698
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.