Rh4BG066800

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
OG0000288
Physical Location & Seq
Reverse (-)
12005318 .. 12006378
1061 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG066800.1

Sequence Viewer

Length: 321 bp
ATGCAGTTATGTCTTTCAAGCTATATTCCAGGTGGCTTTCTTCATGCATGCGATCAAAATCCTACATGCTTCTCTAGGAGGACTTATTGGAACTTGGCCTTTATTTTGTATCAATGCAGAAAGCACATATTGATCCTTTCACACAAGGTATTTGCAAGCCATCTGCAGCTTAAGGGGTTCCGCTCGGAGGGATGGGAAGTGGCAGCATCTCAAGAGGTTTTAGAGGCGAGTTCAGGCAATGGCAAATCATTTCGGGTGCATGTGATGGTTCTCCTGACATGGCCAATCAATTCTCTTAATACCAAGCAGATTATTATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

106

Amino Acids

12.1

Weight (kDa)

9.3

Isoelectric Point (pI)

48.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000288)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G22660 AT1G22660 AT1G22660 AT1G22660 AT1G22660
fragaria_vesca FvH4_4g33440 FvH4_4g33440 FvH4_4g33440 FvH4_4g33440 FvH4_4g33440 FvH4_4g33440 FvH4_4g33440 FvH4_4g33440 FvH4_4g33440 FvH4_4g33440 FvH4_4g33440 FvH4_4g33440 FvH4_4g33440 FvH4_4g33440 FvH4_4g33440
malus_domestica MD05G1045700.v1.1 MD10G1052700.v1.1
prunus_persica Prupe.6G147900_v2.0.a1 Prupe.6G147900_v2.0.a1
pyrus_communis pycom05g03810 pycom10g03770
rosa_chinensis RchiOBHm_Chr3g0457671 RchiOBHm_Chr4g0411681 RchiOBHm_Chr4g0411871 RchiOBHm_Chr4g0412011 RchiOBHm_Chr4g0442691 RchiOBHm_Chr5g0054011 RchiOBHm_Chr7g0192731 RchiOBHm_Chr7g0217301 RchiOBHm_Chr7g0217311
rosa_laevigata RLG00000002496 RLG00000002497 RLG00000004333 RLG00000005141 RLG00000005991 RLG00000008329 RLG00000008334
rosa_multiflora Rmu_co8052866.1_g000001 Rmu_sc0000124.1_g000041 Rmu_sc0000711.1_g000018 Rmu_sc0000711.1_g000026 Rmu_sc0000711.1_g000049 Rmu_sc0001260.1_g000024 Rmu_sc0002040.1_g000016 Rmu_sc0003311.1_g000009 Rmu_sc0003541.1_g000049 Rmu_sc0007633.1_g000011 Rmu_sc0007784.1_g000001 Rmu_sc0007843.1_g000002 Rmu_sc0018873.1_g000007 Rmu_sc0037239.1_g000001 Rmu_ssc0000204.1_g000025
rosa_roxburghii Rroxscaffold_1G00010150 Rroxscaffold_2G00085070 Rroxscaffold_3G00237950 Rroxscaffold_3G00238000 Rroxscaffold_3G00238060 Rroxscaffold_3G00242460 Rroxscaffold_5G00356230 Rroxscaffold_5G00356320 Rroxscaffold_5G00357990 Rroxscaffold_5G00383500
rosa_rugosa Rorug04G0107400 Rorug04G0107400 Rorug04G0342400.1 Rorug04G0342500.1 Rorug04G0342600.1 Rorug06G0053100 Rorug06G0099700 Rorug07G0004300 Rorug07G0167800 Rorug07G0167900
rosa_samantha Rh2CG570300 Rh2DG609200 Rh4AG068500 Rh4AG169600 Rh4AG169900 Rh4AG170200 Rh4AG170600 Rh4AG202600 Rh4AG394800 Rh4BG066700 Rh4BG066800 Rh4BG166500 Rh4BG166600 Rh4BG166700 Rh4BG167000 Rh4BG167300 Rh4BG168500 Rh4BG169200 Rh4BG208600 Rh4BG407700 Rh4CG074000 Rh4CG181100 Rh4CG181200 Rh4CG181700 Rh4CG423100 Rh4DG163900 Rh4DG164400 Rh4DG165100 Rh4DG165200 Rh4DG200000 Rh4DG401800 Rh6BG194500 Rh6CG100200 Rh7AG129300 Rh7AG307100 Rh7BG130700 Rh7BG298000 Rh7CG134100 Rh7DG131500 Rh7DG306700
rosa_wichuraiana Rw0G007750 Rw4G014080 Rw4G014120 Rw4G014180 Rw4G017150 Rw4G034120 Rw7G011060

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 183
AciI CCGC 1 cut(s) 181
AclWI GGATC 1 cut(s) 127
AcoI YGGCCR 1 cut(s) 281
AfiI CCNNNNNNNGG 1 cut(s) 187
AflII CTTAAG 1 cut(s) 170
AgsI TTSAA 1 cut(s) 18
AjnI CCWGG 1 cut(s) 28
AluBI AGCT 2 cut(s) 21, 169
AluI AGCT 2 cut(s) 21, 169
AlwI GGATC 1 cut(s) 127
AoxI GGCC 2 cut(s) 96, 281
ApeKI GCWGC 2 cut(s) 166, 203
BalI TGGCCA 1 cut(s) 283
BbvI GCAGC 2 cut(s) 178, 215
BccI CCATC 3 cut(s) 168, 186, 259
BciT130I CCWGG 1 cut(s) 30
BfaI CTAG 1 cut(s) 75
BfmI CTRYAG 1 cut(s) 164
BfrI CTTAAG 1 cut(s) 170
BisI GCNGC 2 cut(s) 167, 204
BlsI GCNGC 2 cut(s) 168, 205
Bme1390I CCNGG 1 cut(s) 30
BmiI GGNNCC 1 cut(s) 179
BmrFI CCNGG 1 cut(s) 30
BmsI GCATC 1 cut(s) 215
BpuEI CTTGAG 1 cut(s) 195
BsaBI GATNNNNATC 1 cut(s) 57
Bsc4I CCNNNNNNNGG 1 cut(s) 187
Bse3DI GCAATG 1 cut(s) 244
Bse8I GATNNNNATC 1 cut(s) 57
BseBI CCWGG 1 cut(s) 30
BseGI GGATG 1 cut(s) 197
BseJI GATNNNNATC 1 cut(s) 57
BseLI CCNNNNNNNGG 1 cut(s) 187
BseMI GCAATG 1 cut(s) 244
BseXI GCAGC 2 cut(s) 178, 215
BshFI GGCC 2 cut(s) 98, 283
BslI CCNNNNNNNGG 1 cut(s) 187
BsnI GGCC 2 cut(s) 98, 283
Bsp143I GATC 2 cut(s) 52, 132
BspACI CCGC 1 cut(s) 181
BspANI GGCC 2 cut(s) 98, 283
BspLI GGNNCC 1 cut(s) 179
BspMAI CTGCAG 1 cut(s) 168
BspPI GGATC 1 cut(s) 127
BspTI CTTAAG 1 cut(s) 170
BsrBI CCGCTC 1 cut(s) 183
BsrDI GCAATG 1 cut(s) 244
BssMI GATC 2 cut(s) 52, 132
Bst2UI CCWGG 1 cut(s) 30
BstAFI CTTAAG 1 cut(s) 170
BstC8I GCNNGC 2 cut(s) 49, 157
BstF5I GGATG 1 cut(s) 197
BstKTI GATC 2 cut(s) 55, 135
BstMBI GATC 2 cut(s) 52, 132
BstNI CCWGG 1 cut(s) 30
BstNSI RCATGY 3 cut(s) 51, 69, 263
BstSCI CCNGG 1 cut(s) 28
BstSFI CTRYAG 1 cut(s) 164
BstV1I GCAGC 2 cut(s) 178, 215
BsuRI GGCC 2 cut(s) 98, 283
BtsCI GGATG 1 cut(s) 197
Cac8I GCNNGC 2 cut(s) 49, 157
CviAII CATG 5 cut(s) 44, 48, 66, 260, 279
CviJI RGCY 6 cut(s) 21, 36, 98, 159, 169, 283
CviKI_1 RGCY 6 cut(s) 21, 36, 98, 159, 169, 283
DpnI GATC 2 cut(s) 54, 134
DpnII GATC 2 cut(s) 52, 132
EaeI YGGCCR 1 cut(s) 281
EcoRII CCWGG 1 cut(s) 28
EcoT22I ATGCAT 1 cut(s) 49
FaeI CATG 5 cut(s) 47, 51, 69, 263, 282
FaiI YATR 8 cut(s) 10, 24, 45, 49, 67, 128, 261, 280
FatI CATG 5 cut(s) 43, 47, 65, 259, 278
Fnu4HI GCNGC 2 cut(s) 167, 204
FokI GGATG 1 cut(s) 204
Fsp4HI GCNGC 2 cut(s) 167, 204
FspBI CTAG 1 cut(s) 75
GluI GCNGC 2 cut(s) 167, 204
HaeIII GGCC 2 cut(s) 98, 283
Hin1II CATG 5 cut(s) 47, 51, 69, 263, 282
Hpy188I TCNGA 1 cut(s) 187
Hpy188III TCNNGA 2 cut(s) 212, 274
HpyCH4V TGCA 6 cut(s) 4, 47, 117, 155, 166, 259
Hsp92II CATG 5 cut(s) 47, 51, 69, 263, 282
Kzo9I GATC 2 cut(s) 52, 132
LpnPI CCDG 4 cut(s) 15, 42, 219, 287
Lsp1109I GCAGC 2 cut(s) 178, 215
LweI GCATC 1 cut(s) 215
MaeI CTAG 1 cut(s) 75
MalI GATC 2 cut(s) 54, 134
MbiI CCGCTC 1 cut(s) 183
MboI GATC 2 cut(s) 52, 132
MboII GAAGA 1 cut(s) 32
MlsI TGGCCA 1 cut(s) 283
MluCI AATT 1 cut(s) 289
MluNI TGGCCA 1 cut(s) 283
MnlI CCTC 4 cut(s) 72, 181, 208, 217
Mox20I TGGCCA 1 cut(s) 283
Mph1103I ATGCAT 1 cut(s) 49
MscI TGGCCA 1 cut(s) 283
MseI TTAA 2 cut(s) 171, 297
Msp20I TGGCCA 1 cut(s) 283
MspCI CTTAAG 1 cut(s) 170
MspR9I CCNGG 1 cut(s) 30
MvaI CCWGG 1 cut(s) 30
NdeII GATC 2 cut(s) 52, 132
NlaIII CATG 5 cut(s) 47, 51, 69, 263, 282
NlaIV GGNNCC 1 cut(s) 179
NsiI ATGCAT 1 cut(s) 49
NspI RCATGY 3 cut(s) 51, 69, 263
PaeI GCATGC 1 cut(s) 51
PkrI GCNGC 2 cut(s) 168, 205
Psp6I CCWGG 1 cut(s) 28
PspGI CCWGG 1 cut(s) 28
PspN4I GGNNCC 1 cut(s) 179
PstI CTGCAG 1 cut(s) 168
SaqAI TTAA 2 cut(s) 171, 297
SatI GCNGC 2 cut(s) 167, 204
Sau3AI GATC 2 cut(s) 52, 132
ScrFI CCNGG 1 cut(s) 30
SetI ASST 5 cut(s) 23, 34, 150, 171, 219
SfaNI GCATC 1 cut(s) 215
SfcI CTRYAG 1 cut(s) 164
SmlI CTYRAG 2 cut(s) 170, 210
SmoI CTYRAG 2 cut(s) 170, 210
SphI GCATGC 1 cut(s) 51
Sse9I AATT 1 cut(s) 289
SsiI CCGC 1 cut(s) 181
SspMI CTAG 1 cut(s) 75
StyD4I CCNGG 1 cut(s) 28
TasI AATT 1 cut(s) 289
Tru1I TTAA 2 cut(s) 171, 297
Tru9I TTAA 2 cut(s) 171, 297
TseI GCWGC 2 cut(s) 166, 203
TspDTI ATGAA 1 cut(s) 32
Vha464I CTTAAG 1 cut(s) 170
XceI RCATGY 3 cut(s) 51, 69, 263
XspI CTAG 1 cut(s) 75
Zsp2I ATGCAT 1 cut(s) 49
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.