Rh7CG183600

Intermembrane space import and assembly protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
Physical Location & Seq
Forward (+)
16007206 .. 16008733
1528 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG183600.1

Sequence Viewer

Length: 225 bp
ATGTTCACCAAAATAGCAGCATATGGCAATGATGGGAATGAGGGATCAGACTGTGTGCATCCGTTTGTAATTTTGCAGAATTGTATTAAAGCTAATCCAGATGCCTTTTCTAACAACATTTCAGAAGAAGATGGAGTTAAGAAGGAGGAAAACCTGACCCAGGATTACAAAATTATCCCACCCCTATGGTCCAAAGAATCCCCTAGTCCAAAATCCAAGCTGTAG

Protein Analysis

74

Amino Acids

8.21

Weight (kDa)

4.94

Isoelectric Point (pI)

51.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000604)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G51740 AT5G51740 AT5G51740
fragaria_vesca FvH4_7g28431 FvH4_7g28432
malus_domestica MD01G1187900.v1.1 MD07G1015000.v1.1 MD07G1260500.v1.1
prunus_persica Prupe.2G284300_v2.0.a1 Prupe.2G284400_v2.0.a1
pyrus_communis pycom01g19990 pycom07g23380 pycom07g23540 pycom07g23740
rosa_chinensis RchiOBHm_Chr1g0342951 RchiOBHm_Chr1g0375391 RchiOBHm_Chr1g0375401 RchiOBHm_Chr1g0375411 RchiOBHm_Chr2g0123811 RchiOBHm_Chr4g0391111 RchiOBHm_Chr4g0406741 RchiOBHm_Chr5g0031101 RchiOBHm_Chr7g0214411
rosa_laevigata RLG00000004191 RLG00000019338 RLG00000026663 RLG00000026664
rosa_multiflora Rmu_sc0000554.1_g000043 Rmu_sc0000554.1_g000047 Rmu_sc0001966.1_g000052 Rmu_sc0002169.1_g000012 Rmu_sc0006244.1_g000048 Rmu_sc0007176.1_g000002 Rmu_sc0014983.1_g000004 Rmu_sc0020175.1_g000003 Rmu_sc0021990.1_g000003 Rmu_ssc0000106.1_g000001
rosa_roxburghii Rroxscaffold_1G00029630 Rroxscaffold_1G00049160 Rroxscaffold_3G00235470 Rroxscaffold_3G00235480 Rroxscaffold_4G00282790 Rroxscaffold_4G00282800 Rroxscaffold_5G00357450 Rroxscaffold_5G00360550
rosa_rugosa Rorug01G0390800 Rorug01G0390800 Rorug06G0413000
rosa_samantha Rh1AG177000 Rh1AG401300 Rh1AG401400 Rh1BG362700 Rh1BG363000 Rh1BG363100 Rh1BG366200 Rh1CG376300 Rh1CG378900 Rh1DG069900 Rh1DG393500 Rh1DG393800 Rh1DG393900 Rh1DG396800 Rh2AG166900 Rh2DG172200 Rh2DG463600 Rh3CG274900 Rh4BG226700 Rh5AG215800 Rh5AG215900 Rh5BG215300 Rh5CG238800 Rh5DG219700 Rh5DG219800 Rh6BG136300 Rh6CG134700 Rh6DG121000 Rh7CG183600 Rh7DG190700
rosa_wichuraiana Rw1G035620 Rw1G035630

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 52
AfiI CCNNNNNNNGG 1 cut(s) 160
AjnI CCWGG 1 cut(s) 159
AluBI AGCT 2 cut(s) 92, 220
AluI AGCT 2 cut(s) 92, 220
AlwI GGATC 1 cut(s) 52
ApeKI GCWGC 1 cut(s) 17
AspS9I GGNCC 1 cut(s) 189
AvaII GGWCC 1 cut(s) 189
BbvI GCAGC 1 cut(s) 29
BccI CCATC 2 cut(s) 26, 125
BciT130I CCWGG 1 cut(s) 161
BfaI CTAG 1 cut(s) 204
BfmI CTRYAG 1 cut(s) 221
BisI GCNGC 1 cut(s) 18
BlsI GCNGC 1 cut(s) 19
Bme1390I CCNGG 1 cut(s) 161
Bme18I GGWCC 1 cut(s) 189
BmgT120I GGNCC 1 cut(s) 189
BmrFI CCNGG 1 cut(s) 161
BmsI GCATC 2 cut(s) 67, 91
BsaJI CCNNGG 1 cut(s) 159
Bsc4I CCNNNNNNNGG 1 cut(s) 160
Bse3DI GCAATG 1 cut(s) 34
BseBI CCWGG 1 cut(s) 161
BseDI CCNNGG 1 cut(s) 159
BseGI GGATG 1 cut(s) 58
BseLI CCNNNNNNNGG 1 cut(s) 160
BseMI GCAATG 1 cut(s) 34
BseXI GCAGC 1 cut(s) 29
BslI CCNNNNNNNGG 1 cut(s) 160
Bsp143I GATC 1 cut(s) 44
BspPI GGATC 1 cut(s) 52
BsrDI GCAATG 1 cut(s) 34
BssECI CCNNGG 1 cut(s) 159
BssMI GATC 1 cut(s) 44
Bst2UI CCWGG 1 cut(s) 161
Bst4CI ACNGT 1 cut(s) 53
BstENI CCTNNNNNAGG 1 cut(s) 158
BstF5I GGATG 1 cut(s) 58
BstKTI GATC 1 cut(s) 47
BstMBI GATC 1 cut(s) 44
BstNI CCWGG 1 cut(s) 161
BstSCI CCNGG 1 cut(s) 159
BstSFI CTRYAG 1 cut(s) 221
BstV1I GCAGC 1 cut(s) 29
BstXI CCANNNNNNTGG 1 cut(s) 186
BtsCI GGATG 1 cut(s) 58
Cfr13I GGNCC 1 cut(s) 189
CviJI RGCY 2 cut(s) 92, 220
CviKI_1 RGCY 2 cut(s) 92, 220
DpnI GATC 1 cut(s) 46
DpnII GATC 1 cut(s) 44
Eco47I GGWCC 1 cut(s) 189
EcoNI CCTNNNNNAGG 1 cut(s) 158
EcoRII CCWGG 1 cut(s) 159
FaiI YATR 3 cut(s) 22, 24, 187
FauNDI CATATG 1 cut(s) 22
Fnu4HI GCNGC 1 cut(s) 18
FokI GGATG 1 cut(s) 45
Fsp4HI GCNGC 1 cut(s) 18
FspBI CTAG 1 cut(s) 204
GluI GCNGC 1 cut(s) 18
HinfI GANTC 1 cut(s) 197
Hpy166II GTNNAC 1 cut(s) 6
Hpy188I TCNGA 2 cut(s) 49, 124
Hpy188III TCNNGA 1 cut(s) 98
Hpy8I GTNNAC 1 cut(s) 6
HpyAV CCTTC 1 cut(s) 136
HpyCH4III ACNGT 1 cut(s) 53
HpyCH4V TGCA 2 cut(s) 58, 76
Kzo9I GATC 1 cut(s) 44
LpnPI CCDG 4 cut(s) 111, 146, 167, 173
Lsp1109I GCAGC 1 cut(s) 29
LweI GCATC 2 cut(s) 67, 91
MaeI CTAG 1 cut(s) 204
MalI GATC 1 cut(s) 46
MboI GATC 1 cut(s) 44
MboII GAAGA 2 cut(s) 137, 140
MluCI AATT 3 cut(s) 69, 79, 171
MnlI CCTC 2 cut(s) 34, 139
MseI TTAA 2 cut(s) 87, 138
MslI CAYNNNNRTG 1 cut(s) 184
MspR9I CCNGG 1 cut(s) 161
MvaI CCWGG 1 cut(s) 161
NdeI CATATG 1 cut(s) 22
NdeII GATC 1 cut(s) 44
PfeI GAWTC 1 cut(s) 197
PkrI GCNGC 1 cut(s) 19
Psp6I CCWGG 1 cut(s) 159
PspGI CCWGG 1 cut(s) 159
PspPI GGNCC 1 cut(s) 189
RseI CAYNNNNRTG 1 cut(s) 184
SaqAI TTAA 2 cut(s) 87, 138
SatI GCNGC 1 cut(s) 18
Sau3AI GATC 1 cut(s) 44
Sau96I GGNCC 1 cut(s) 189
ScrFI CCNGG 1 cut(s) 161
SetI ASST 3 cut(s) 94, 156, 222
SfaNI GCATC 2 cut(s) 67, 91
SfcI CTRYAG 1 cut(s) 221
SgeI CNNG 5 cut(s) 110, 166, 172, 173, 216
SinI GGWCC 1 cut(s) 189
SmiMI CAYNNNNRTG 1 cut(s) 184
Sse9I AATT 3 cut(s) 69, 79, 171
SspMI CTAG 1 cut(s) 204
StyD4I CCNGG 1 cut(s) 159
TaaI ACNGT 1 cut(s) 53
TasI AATT 3 cut(s) 69, 79, 171
TfiI GAWTC 1 cut(s) 197
Tru1I TTAA 2 cut(s) 87, 138
Tru9I TTAA 2 cut(s) 87, 138
TseI GCWGC 1 cut(s) 17
TspGWI ACGGA 1 cut(s) 51
VpaK11BI GGWCC 1 cut(s) 189
XagI CCTNNNNNAGG 1 cut(s) 158
XspI CTAG 1 cut(s) 204
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.