Rh7DG332700

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
Physical Location & Seq
Forward (+)
40797572 .. 40798277
706 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG332700.1

Sequence Viewer

Length: 396 bp
ATGGGTTTGAAGAACGCTGCGGATATTGCCACTAACGCTAAACGAGTTGACAAGCTAGGTCAGTCTGTGAACAATCCAGCAGATGAACTTGCGAAACGTATGGAGGAGGACAGGGAAAGGGCGAAGCAAGAAAGCGAGCTTATTCTGAATCGTATAATCAAGGACGAGGAAAGGGCGAGGAAAGAAGCGGAGTGTATTCTGAATCGTATAAACGAGGACGTGGAAAGGGCGAAGGAAGAAGCCAAGCAACGCGCTCGTGCTGTAGAAAAAGAAATTATACTGGTCAATGAAAAAATCGCCAAAGTCAGAACGGAGACAGAAATGCTCAATATGAAAATGAAGCACAAACTGGAGAAGGCTAATGCTCGCTTGGCCAACGGAGCCAACACCAGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

131

Amino Acids

14.98

Weight (kDa)

9.01

Isoelectric Point (pI)

43.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 252
AciI CCGC 2 cut(s) 20, 188
AcoI YGGCCR 1 cut(s) 372
AgsI TTSAA 1 cut(s) 10
AjiI CACGTC 1 cut(s) 220
AluBI AGCT 3 cut(s) 55, 139, 393
AluI AGCT 3 cut(s) 55, 139, 393
Alw26I GTCTC 1 cut(s) 308
AoxI GGCC 1 cut(s) 372
ApeKI GCWGC 1 cut(s) 17
AspLEI GCGC 1 cut(s) 254
BalI TGGCCA 1 cut(s) 374
BauI CACGAG 1 cut(s) 255
BbvI GCAGC 1 cut(s) 4
BcgI CGANNNNNNTGC 2 cut(s) 236, 270
BcoDI GTCTC 1 cut(s) 308
BfaI CTAG 1 cut(s) 56
BfmI CTRYAG 1 cut(s) 261
BisI GCNGC 1 cut(s) 18
BlsI GCNGC 1 cut(s) 19
BmgBI CACGTC 1 cut(s) 220
BmiI GGNNCC 1 cut(s) 382
BpmI CTGGAG 1 cut(s) 371
Bse1I ACTGG 2 cut(s) 285, 354
BseNI ACTGG 2 cut(s) 285, 354
BseRI GAGGAG 1 cut(s) 119
BseXI GCAGC 1 cut(s) 4
Bsh1236I CGCG 1 cut(s) 252
BshFI GGCC 1 cut(s) 374
BsmAI GTCTC 1 cut(s) 308
BsnI GGCC 1 cut(s) 374
BspACI CCGC 2 cut(s) 20, 188
BspANI GGCC 1 cut(s) 374
BspFNI CGCG 1 cut(s) 252
BspLI GGNNCC 1 cut(s) 382
BsrI ACTGG 2 cut(s) 285, 354
BssSI CACGAG 1 cut(s) 255
Bst2BI CACGAG 1 cut(s) 255
BstC8I GCNNGC 2 cut(s) 137, 367
BstFNI CGCG 1 cut(s) 252
BstHHI GCGC 1 cut(s) 254
BstMAI GTCTC 1 cut(s) 308
BstMWI GCNNNNNNNGC 4 cut(s) 26, 35, 371, 380
BstSFI CTRYAG 1 cut(s) 261
BstUI CGCG 1 cut(s) 252
BstV1I GCAGC 1 cut(s) 4
BsuRI GGCC 1 cut(s) 374
BtrI CACGTC 1 cut(s) 220
Cac8I GCNNGC 2 cut(s) 137, 367
CfoI GCGC 1 cut(s) 254
CviJI RGCY 7 cut(s) 55, 139, 242, 359, 374, 383, 393
CviKI_1 RGCY 7 cut(s) 55, 139, 242, 359, 374, 383, 393
EaeI YGGCCR 1 cut(s) 372
FaiI YATR 5 cut(s) 101, 155, 209, 278, 332
Fnu4HI GCNGC 1 cut(s) 18
Fsp4HI GCNGC 1 cut(s) 18
FspBI CTAG 1 cut(s) 56
GlaI GCGC 1 cut(s) 253
GluI GCNGC 1 cut(s) 18
GsuI CTGGAG 1 cut(s) 371
HaeIII GGCC 1 cut(s) 374
HhaI GCGC 1 cut(s) 254
Hin6I GCGC 1 cut(s) 252
HinP1I GCGC 1 cut(s) 252
HincII GTYRAC 1 cut(s) 49
HindII GTYRAC 1 cut(s) 49
HinfI GANTC 2 cut(s) 148, 202
Hpy166II GTNNAC 2 cut(s) 49, 70
Hpy188I TCNGA 3 cut(s) 147, 201, 308
Hpy8I GTNNAC 2 cut(s) 49, 70
HpyAV CCTTC 2 cut(s) 226, 349
HpyCH4IV ACGT 2 cut(s) 97, 219
HpyF10VI GCNNNNNNNGC 4 cut(s) 26, 35, 371, 380
HpySE526I ACGT 2 cut(s) 97, 219
HspAI GCGC 1 cut(s) 252
LmnI GCTCC 1 cut(s) 380
LpnPI CCDG 4 cut(s) 90, 97, 266, 335
Lsp1109I GCAGC 1 cut(s) 4
MaeI CTAG 1 cut(s) 56
MaeII ACGT 2 cut(s) 97, 219
MboII GAAGA 2 cut(s) 22, 248
MlsI TGGCCA 1 cut(s) 374
MluCI AATT 1 cut(s) 273
MluNI TGGCCA 1 cut(s) 374
MnlI CCTC 5 cut(s) 97, 100, 160, 171, 208
Mox20I TGGCCA 1 cut(s) 374
MscI TGGCCA 1 cut(s) 374
Msp20I TGGCCA 1 cut(s) 374
MvnI CGCG 1 cut(s) 252
MwoI GCNNNNNNNGC 4 cut(s) 26, 35, 371, 380
NlaIV GGNNCC 1 cut(s) 382
PfeI GAWTC 2 cut(s) 148, 202
PkrI GCNGC 1 cut(s) 19
PspN4I GGNNCC 1 cut(s) 382
SatI GCNGC 1 cut(s) 18
SetI ASST 6 cut(s) 57, 61, 100, 141, 222, 395
SfcI CTRYAG 1 cut(s) 261
Sse9I AATT 1 cut(s) 273
SsiI CCGC 2 cut(s) 20, 188
SspMI CTAG 1 cut(s) 56
TaiI ACGT 2 cut(s) 100, 222
TasI AATT 1 cut(s) 273
TfiI GAWTC 2 cut(s) 148, 202
TseI GCWGC 1 cut(s) 17
TspDTI ATGAA 4 cut(s) 99, 303, 347, 353
TspGWI ACGGA 2 cut(s) 326, 393
XspI CTAG 1 cut(s) 56
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.