Basic Information

Type: gene

Biological Identity

Species

fragaria_vesca

Chromosome

Fvb3

Orthogroup ID

OG0000866

Physical Location & Seq

Genomic Coordinates Forward (+)

16773963 .. 16774994

Gene Structure 1032 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

FvH4_3g23680.t1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 273 bp

ATGGCATTCTCAAAGACTGTTCTTCTGGTTGCTCTTGTCTTTGCTTTTCTCCTCATCTCTTCTGAGGTCTCAGCTCATGAAAATTCTGACCACTTCCACGGCGGCGACGAGCATGGACATGGTGGCCATGGAAATGGAGGACATGGAGGCCGAGGAGGGCATGGAGGACAAGGAGGGCATGGAGGACAGGGAGGGCATGGAGGACGCGGTGGCCATGGAGGACGTGGAGGGCACGGAGGGCACGGACCAGGTGCTCAGGAAACTGAGAATTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

91

Amino Acids

8.71

Weight (kDa)

6.47

Isoelectric Point (pI)

17.02

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000866)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g23680 FvH4_6g21640 FvH4_6g21640 FvH4_6g21650 FvH4_6g21660 FvH4_6g21660 FvH4_6g21670
malus_domestica	MD03G1191700.v1.1 MD03G1191900.v1.1 MD03G1192000.v1.1
prunus_persica	Prupe.4G225300_v2.0.a1 Prupe.4G225500_v2.0.a1 Prupe.4G225500_v2.0.a1 Prupe.4G225600_v2.0.a1 Prupe.4G225700_v2.0.a1 Prupe.4G225800_v2.0.a1 Prupe.4G226000_v2.0.a1 Prupe.4G226100_v2.0.a1 Prupe.4G226200_v2.0.a1 Prupe.4G227100_v2.0.a1
rosa_chinensis	RchiOBHm_Chr1g0339861 RchiOBHm_Chr1g0339881 RchiOBHm_Chr3g0478901 RchiOBHm_Chr5g0041801 RchiOBHm_Chr5g0041811
rosa_laevigata	RLG00000029243 RLG00000034095
rosa_multiflora	Rmu_co7998732.1_g000001 Rmu_co8433149.1_g000001 Rmu_sc0000861.1_g000038 Rmu_sc0003498.1_g000013 Rmu_sc0005255.1_g000010
rosa_roxburghii	Rroxscaffold_1G00038720 Rroxscaffold_1G00038730 Rroxscaffold_4G00313770 Rroxscaffold_4G00313780 Rroxscaffold_4G00315370 Rroxscaffold_4G00315380 Rroxscaffold_6G00402890
rosa_rugosa	Rorug01G0124600 Rorug01G0124700 Rorug01G0138700.1 Rorug01G0139000.1 Rorug01G0139200.1 Rorug01G0139300.1 Rorug03G0169100 Rorug03G0169200 Rorug03G0169200 Rorug05G0195300 Rorug05G0195400
rosa_samantha	Rh1AG157200 Rh1CG146900 Rh3AG220700 Rh3BG252600 Rh3CG249400 Rh5AG280600 Rh5AG280700 Rh5BG286600 Rh5DG295300
rosa_wichuraiana	Rw1G012890 Rw1G012900 Rw1G012910 Rw1G012920 Rw1G012950 Rw1G012970 Rw3G019850 Rw5G026470

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccII	CGCG	1 cut(s)	207
AciI	CCGC	2 cut(s)	102, 207
AcoI	YGGCCR	2 cut(s)	124, 211
AcsI	RAATTY	1 cut(s)	82
AjiI	CACGTC	1 cut(s)	224
AjnI	CCWGG	1 cut(s)	247
AluBI	AGCT	1 cut(s)	74
AluI	AGCT	1 cut(s)	74
Alw21I	GWGCWC	1 cut(s)	256
Alw26I	GTCTC	1 cut(s)	73
AoxI	GGCC	3 cut(s)	124, 148, 211
ApoI	RAATTY	1 cut(s)	82
AspS9I	GGNCC	1 cut(s)	245
AvaII	GGWCC	1 cut(s)	245
BaeGI	GKGCMC	2 cut(s)	234, 243
BalI	TGGCCA	2 cut(s)	126, 213
Bbv12I	GWGCWC	1 cut(s)	256
BceAI	ACGGC	1 cut(s)	115
BciT130I	CCWGG	1 cut(s)	249
BcoDI	GTCTC	1 cut(s)	73
BisI	GCNGC	1 cut(s)	103
BlsI	GCNGC	1 cut(s)	104
Bme1390I	CCNGG	1 cut(s)	249
Bme18I	GGWCC	1 cut(s)	245
BmgBI	CACGTC	1 cut(s)	224
BmgT120I	GGNCC	1 cut(s)	245
BmrFI	CCNGG	1 cut(s)	249
Bpu10I	CCTNAGC	1 cut(s)	255
BsaI	GGTCTC	1 cut(s)	73
BsaJI	CCNNGG	4 cut(s)	97, 127, 151, 214
BseBI	CCWGG	1 cut(s)	249
BseDI	CCNNGG	4 cut(s)	97, 127, 151, 214
BseMII	CTCAG	4 cut(s)	54, 84, 255, 269
BseRI	GAGGAG	2 cut(s)	41, 168
BseSI	GKGCMC	2 cut(s)	234, 243
Bsh1236I	CGCG	1 cut(s)	207
BshFI	GGCC	3 cut(s)	126, 150, 213
BsiHKAI	GWGCWC	1 cut(s)	256
BsmAI	GTCTC	1 cut(s)	73
BsmI	GAATGC	1 cut(s)	5
BsnI	GGCC	3 cut(s)	126, 150, 213
Bso31I	GGTCTC	1 cut(s)	73
Bsp1286I	GDGCHC	3 cut(s)	234, 243, 256
Bsp19I	CCATGG	2 cut(s)	127, 214
BspACI	CCGC	2 cut(s)	102, 207
BspANI	GGCC	3 cut(s)	126, 150, 213
BspCNI	CTCAG	4 cut(s)	55, 83, 256, 268
BspFNI	CGCG	1 cut(s)	207
BspHI	TCATGA	1 cut(s)	76
BspTNI	GGTCTC	1 cut(s)	73
BssECI	CCNNGG	4 cut(s)	97, 127, 151, 214
BssT1I	CCWWGG	2 cut(s)	127, 214
Bst2UI	CCWGG	1 cut(s)	249
Bst4CI	ACNGT	1 cut(s)	19
Bst6I	CTCTTC	1 cut(s)	64
BstDEI	CTNAG	4 cut(s)	63, 70, 255, 264
BstDSI	CCRYGG	3 cut(s)	97, 127, 214
BstFNI	CGCG	1 cut(s)	207
BstMAI	GTCTC	1 cut(s)	73
BstMWI	GCNNNNNNNGC	1 cut(s)	238
BstNI	CCWGG	1 cut(s)	249
BstSCI	CCNGG	1 cut(s)	247
BstSLI	GKGCMC	2 cut(s)	234, 243
BstUI	CGCG	1 cut(s)	207
BstXI	CCANNNNNNTGG	1 cut(s)	134
BsuRI	GGCC	3 cut(s)	126, 150, 213
BtgI	CCRYGG	3 cut(s)	97, 127, 214
BtrI	CACGTC	1 cut(s)	224
CciI	TCATGA	1 cut(s)	76
Cfr13I	GGNCC	1 cut(s)	245
CseI	GACGC	1 cut(s)	213
CsiI	ACCWGGT	1 cut(s)	247
CviAII	CATG	9 cut(s)	77, 113, 119, 128, 143, 161, 179, 197, 215
CviJI	RGCY	4 cut(s)	74, 126, 150, 213
CviKI_1	RGCY	4 cut(s)	74, 126, 150, 213
DdeI	CTNAG	4 cut(s)	63, 70, 255, 264
EaeI	YGGCCR	2 cut(s)	124, 211
Eam1104I	CTCTTC	1 cut(s)	64
EarI	CTCTTC	1 cut(s)	64
Eco130I	CCWWGG	2 cut(s)	127, 214
Eco31I	GGTCTC	1 cut(s)	73
Eco47I	GGWCC	1 cut(s)	245
EcoRII	CCWGG	1 cut(s)	247
EcoT14I	CCWWGG	2 cut(s)	127, 214
ErhI	CCWWGG	2 cut(s)	127, 214
FaeI	CATG	9 cut(s)	80, 116, 122, 131, 146, 164, 182, 200, 218
FaiI	YATR	9 cut(s)	78, 114, 120, 129, 144, 162, 180, 198, 216
FatI	CATG	9 cut(s)	76, 112, 118, 127, 142, 160, 178, 196, 214
Fnu4HI	GCNGC	1 cut(s)	103
Fsp4HI	GCNGC	1 cut(s)	103
GluI	GCNGC	1 cut(s)	103
HaeIII	GGCC	3 cut(s)	126, 150, 213
HgaI	GACGC	1 cut(s)	213
Hin1II	CATG	9 cut(s)	80, 116, 122, 131, 146, 164, 182, 200, 218
Hpy188I	TCNGA	2 cut(s)	64, 88
Hpy188III	TCNNGA	2 cut(s)	77, 257
Hpy99I	CGWCG	1 cut(s)	110
HpyCH4III	ACNGT	1 cut(s)	19
HpyCH4IV	ACGT	1 cut(s)	223
HpyF10VI	GCNNNNNNNGC	1 cut(s)	238
HpyF3I	CTNAG	4 cut(s)	63, 70, 255, 264
HpySE526I	ACGT	1 cut(s)	223
Hsp92II	CATG	9 cut(s)	80, 116, 122, 131, 146, 164, 182, 200, 218
LpnPI	CCDG	5 cut(s)	11, 173, 234, 242, 261
MabI	ACCWGGT	1 cut(s)	247
MaeII	ACGT	1 cut(s)	223
MboII	GAAGA	2 cut(s)	14, 51
MhlI	GDGCHC	3 cut(s)	234, 243, 256
MlsI	TGGCCA	2 cut(s)	126, 213
MluCI	AATT	2 cut(s)	82, 268
MluNI	TGGCCA	2 cut(s)	126, 213
Mox20I	TGGCCA	2 cut(s)	126, 213
MscI	TGGCCA	2 cut(s)	126, 213
MslI	CAYNNNNRTG	2 cut(s)	117, 132
Msp20I	TGGCCA	2 cut(s)	126, 213
MspR9I	CCNGG	1 cut(s)	249
Mva1269I	GAATGC	1 cut(s)	5
MvaI	CCWGG	1 cut(s)	249
MvnI	CGCG	1 cut(s)	207
MwoI	GCNNNNNNNGC	1 cut(s)	238
NcoI	CCATGG	2 cut(s)	127, 214
NlaIII	CATG	9 cut(s)	80, 116, 122, 131, 146, 164, 182, 200, 218
NmeAIII	GCCGAG	1 cut(s)	176
PagI	TCATGA	1 cut(s)	76
PcsI	WCGNNNNNNNCGW	1 cut(s)	105
PctI	GAATGC	1 cut(s)	5
PkrI	GCNGC	1 cut(s)	104
Psp6I	CCWGG	1 cut(s)	247
PspGI	CCWGG	1 cut(s)	247
PspPI	GGNCC	1 cut(s)	245
RseI	CAYNNNNRTG	2 cut(s)	117, 132
SatI	GCNGC	1 cut(s)	103
Sau96I	GGNCC	1 cut(s)	245
ScrFI	CCNGG	1 cut(s)	249
SduI	GDGCHC	3 cut(s)	234, 243, 256
SetI	ASST	4 cut(s)	69, 76, 226, 253
SexAI	ACCWGGT	1 cut(s)	247
SinI	GGWCC	1 cut(s)	245
SmiMI	CAYNNNNRTG	2 cut(s)	117, 132
Sse9I	AATT	2 cut(s)	82, 268
SsiI	CCGC	2 cut(s)	102, 207
StyD4I	CCNGG	1 cut(s)	247
StyI	CCWWGG	2 cut(s)	127, 214
TaaI	ACNGT	1 cut(s)	19
TaiI	ACGT	1 cut(s)	226
TasI	AATT	2 cut(s)	82, 268
TauI	GCSGC	1 cut(s)	105
TspDTI	ATGAA	1 cut(s)	93
TspGWI	ACGGA	2 cut(s)	249, 258
VpaK11BI	GGWCC	1 cut(s)	245
XapI	RAATTY	1 cut(s)	82
XcmI	CCANNNNNNNNNTGG	1 cut(s)	221

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.