RchiOBHm_Chr5g0041811

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
OG0000866
Physical Location & Seq
Forward (+)
36687560 .. 36688580
1021 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ32024

Sequence Viewer

Length: 234 bp
ATGGCATTCTCAAAGACTATTCTTCTCGTTGCCCTTGTCTTTACTGTTCTCCTCATCTCCTCTGAGGTCTCAGCTCATGAAAATTCTGACCATTTCCACGGCAACGATCATGGACATGGTGGCCATGGACATGGAGGCGAAGGAGGACAGGGAGGACACGGAGGACATGGTGGCCATGGAGGCCGTGGAGGACACGGAGGGCATGGACCTGGTGCTCATGAAACTGAGAATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

77

Amino Acids

7.63

Weight (kDa)

6.18

Isoelectric Point (pI)

14.59

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 2 cut(s) 121, 172
AcsI RAATTY 1 cut(s) 82
AjnI CCWGG 1 cut(s) 208
AluBI AGCT 1 cut(s) 74
AluI AGCT 1 cut(s) 74
Alw21I GWGCWC 1 cut(s) 217
Alw26I GTCTC 1 cut(s) 73
AoxI GGCC 3 cut(s) 121, 172, 181
ApoI RAATTY 1 cut(s) 82
AspS9I GGNCC 1 cut(s) 206
AvaII GGWCC 1 cut(s) 206
BalI TGGCCA 2 cut(s) 123, 174
Bbv12I GWGCWC 1 cut(s) 217
BceAI ACGGC 2 cut(s) 115, 168
BciT130I CCWGG 1 cut(s) 210
BcoDI GTCTC 1 cut(s) 73
BglI GCCNNNNNGGC 1 cut(s) 180
Bme1390I CCNGG 1 cut(s) 210
Bme18I GGWCC 1 cut(s) 206
BmgT120I GGNCC 1 cut(s) 206
BmrFI CCNGG 1 cut(s) 210
BsaI GGTCTC 1 cut(s) 73
BsaJI CCNNGG 4 cut(s) 97, 124, 175, 184
BseBI CCWGG 1 cut(s) 210
BseDI CCNNGG 4 cut(s) 97, 124, 175, 184
BseMII CTCAG 3 cut(s) 54, 84, 216
BseRI GAGGAG 2 cut(s) 41, 49
BshFI GGCC 3 cut(s) 123, 174, 183
BsiHKAI GWGCWC 1 cut(s) 217
BsmAI GTCTC 1 cut(s) 73
BsmI GAATGC 1 cut(s) 5
BsnI GGCC 3 cut(s) 123, 174, 183
Bso31I GGTCTC 1 cut(s) 73
Bsp1286I GDGCHC 1 cut(s) 217
Bsp143I GATC 1 cut(s) 106
Bsp19I CCATGG 2 cut(s) 124, 175
BspANI GGCC 3 cut(s) 123, 174, 183
BspCNI CTCAG 3 cut(s) 55, 83, 217
BspHI TCATGA 2 cut(s) 76, 217
BspTNI GGTCTC 1 cut(s) 73
BssECI CCNNGG 4 cut(s) 97, 124, 175, 184
BssMI GATC 1 cut(s) 106
BssT1I CCWWGG 2 cut(s) 124, 175
Bst2UI CCWGG 1 cut(s) 210
Bst4CI ACNGT 1 cut(s) 46
BstDEI CTNAG 3 cut(s) 63, 70, 225
BstDSI CCRYGG 4 cut(s) 97, 124, 175, 184
BstKTI GATC 1 cut(s) 109
BstMAI GTCTC 1 cut(s) 73
BstMBI GATC 1 cut(s) 106
BstMWI GCNNNNNNNGC 1 cut(s) 180
BstNI CCWGG 1 cut(s) 210
BstSCI CCNGG 1 cut(s) 208
BstXI CCANNNNNNTGG 1 cut(s) 131
BsuRI GGCC 3 cut(s) 123, 174, 183
BtgI CCRYGG 4 cut(s) 97, 124, 175, 184
CciI TCATGA 2 cut(s) 76, 217
Cfr13I GGNCC 1 cut(s) 206
CsiI ACCWGGT 1 cut(s) 208
CviAII CATG 9 cut(s) 77, 110, 116, 125, 131, 167, 176, 203, 218
CviJI RGCY 4 cut(s) 74, 123, 174, 183
CviKI_1 RGCY 4 cut(s) 74, 123, 174, 183
DdeI CTNAG 3 cut(s) 63, 70, 225
DpnI GATC 1 cut(s) 108
DpnII GATC 1 cut(s) 106
EaeI YGGCCR 2 cut(s) 121, 172
Eco130I CCWWGG 2 cut(s) 124, 175
Eco31I GGTCTC 1 cut(s) 73
Eco47I GGWCC 1 cut(s) 206
EcoRII CCWGG 1 cut(s) 208
EcoT14I CCWWGG 2 cut(s) 124, 175
ErhI CCWWGG 2 cut(s) 124, 175
FaeI CATG 9 cut(s) 80, 113, 119, 128, 134, 170, 179, 206, 221
FaiI YATR 9 cut(s) 78, 111, 117, 126, 132, 168, 177, 204, 219
FatI CATG 9 cut(s) 76, 109, 115, 124, 130, 166, 175, 202, 217
HaeIII GGCC 3 cut(s) 123, 174, 183
Hin1II CATG 9 cut(s) 80, 113, 119, 128, 134, 170, 179, 206, 221
Hpy188I TCNGA 2 cut(s) 64, 88
Hpy188III TCNNGA 2 cut(s) 77, 218
HpyAV CCTTC 1 cut(s) 134
HpyCH4III ACNGT 1 cut(s) 46
HpyF10VI GCNNNNNNNGC 1 cut(s) 180
HpyF3I CTNAG 3 cut(s) 63, 70, 225
Hsp92II CATG 9 cut(s) 80, 113, 119, 128, 134, 170, 179, 206, 221
Kzo9I GATC 1 cut(s) 106
LpnPI CCDG 3 cut(s) 134, 195, 222
MabI ACCWGGT 1 cut(s) 208
MalI GATC 1 cut(s) 108
MboI GATC 1 cut(s) 106
MboII GAAGA 1 cut(s) 14
MhlI GDGCHC 1 cut(s) 217
MlsI TGGCCA 2 cut(s) 123, 174
MluCI AATT 2 cut(s) 82, 229
MluNI TGGCCA 2 cut(s) 123, 174
Mox20I TGGCCA 2 cut(s) 123, 174
MscI TGGCCA 2 cut(s) 123, 174
MslI CAYNNNNRTG 2 cut(s) 114, 129
Msp20I TGGCCA 2 cut(s) 123, 174
MspR9I CCNGG 1 cut(s) 210
Mva1269I GAATGC 1 cut(s) 5
MvaI CCWGG 1 cut(s) 210
MwoI GCNNNNNNNGC 1 cut(s) 180
NcoI CCATGG 2 cut(s) 124, 175
NdeII GATC 1 cut(s) 106
NlaIII CATG 9 cut(s) 80, 113, 119, 128, 134, 170, 179, 206, 221
PagI TCATGA 2 cut(s) 76, 217
PctI GAATGC 1 cut(s) 5
Psp6I CCWGG 1 cut(s) 208
PspGI CCWGG 1 cut(s) 208
PspPI GGNCC 1 cut(s) 206
RseI CAYNNNNRTG 2 cut(s) 114, 129
Sau3AI GATC 1 cut(s) 106
Sau96I GGNCC 1 cut(s) 206
ScrFI CCNGG 1 cut(s) 210
SduI GDGCHC 1 cut(s) 217
SetI ASST 3 cut(s) 69, 76, 211
SexAI ACCWGGT 1 cut(s) 208
SfiI GGCCNNNNNGGCC 1 cut(s) 180
SinI GGWCC 1 cut(s) 206
SmiMI CAYNNNNRTG 2 cut(s) 114, 129
Sse9I AATT 2 cut(s) 82, 229
StyD4I CCNGG 1 cut(s) 208
StyI CCWWGG 2 cut(s) 124, 175
TaaI ACNGT 1 cut(s) 46
TasI AATT 2 cut(s) 82, 229
TspDTI ATGAA 2 cut(s) 93, 234
TspGWI ACGGA 2 cut(s) 174, 210
VpaK11BI GGWCC 1 cut(s) 206
XapI RAATTY 1 cut(s) 82
XcmI CCANNNNNNNNNTGG 1 cut(s) 182
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.