Rroxscaffold_4G00313770

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Forward (+)
37524802 .. 37525502
701 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00313770.1

Sequence Viewer

Length: 327 bp
ATGGCATTCTCAAAGACTTTTCTTCTTGTCGCCCTTGCCTTTGCTGTTCTCCTCATCTCTGCTGAGGTCTCGGCTCATCGTGACCTAGCTGAGGCTACCACTACTACTCAAAAAGCCAACACTGACGGTTACCACGGACACGATCATGGACATGGCGGCCATGGAGGACATGGTGGACATGGAGGACATGGACCTCATGCTGTTGAGACTGAAAAAGCCAACACTGACGGTTACCATGGACACGATCATGGACATGGCGGCCATGGAGGACACGGAGGACATGGAGGACATGGACCTCATGCTGTTGAGACTGAAACTGAGAACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

108

Amino Acids

10.99

Weight (kDa)

6.12

Isoelectric Point (pI)

10.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 156, 258
AcoI YGGCCR 2 cut(s) 157, 259
AfiI CCNNNNNNNGG 1 cut(s) 91
AluBI AGCT 1 cut(s) 89
AluI AGCT 1 cut(s) 89
Alw26I GTCTC 3 cut(s) 73, 200, 302
AoxI GGCC 2 cut(s) 157, 259
AspS9I GGNCC 2 cut(s) 191, 293
AvaII GGWCC 2 cut(s) 191, 293
BbvCI CCTCAGC 2 cut(s) 63, 90
BcoDI GTCTC 3 cut(s) 73, 200, 302
BfaI CTAG 2 cut(s) 86, 325
BisI GCNGC 2 cut(s) 157, 259
BlsI GCNGC 2 cut(s) 158, 260
Bme18I GGWCC 2 cut(s) 191, 293
BmgT120I GGNCC 2 cut(s) 191, 293
Bpu10I CCTNAGC 2 cut(s) 63, 90
BsaI GGTCTC 1 cut(s) 73
BsaJI CCNNGG 4 cut(s) 133, 160, 235, 262
Bsc4I CCNNNNNNNGG 1 cut(s) 91
BseDI CCNNGG 4 cut(s) 133, 160, 235, 262
BseLI CCNNNNNNNGG 1 cut(s) 91
BseMII CTCAG 3 cut(s) 54, 81, 309
BseRI GAGGAG 1 cut(s) 41
BshFI GGCC 2 cut(s) 159, 261
BslI CCNNNNNNNGG 1 cut(s) 91
BsmAI GTCTC 3 cut(s) 73, 200, 302
BsmI GAATGC 1 cut(s) 5
BsnI GGCC 2 cut(s) 159, 261
Bso31I GGTCTC 1 cut(s) 73
Bsp143I GATC 2 cut(s) 142, 244
Bsp19I CCATGG 3 cut(s) 160, 235, 262
BspACI CCGC 2 cut(s) 156, 258
BspANI GGCC 2 cut(s) 159, 261
BspCNI CTCAG 3 cut(s) 55, 82, 310
BspTNI GGTCTC 1 cut(s) 73
BssECI CCNNGG 4 cut(s) 133, 160, 235, 262
BssMI GATC 2 cut(s) 142, 244
BssT1I CCWWGG 3 cut(s) 160, 235, 262
Bst4CI ACNGT 2 cut(s) 128, 230
BstDEI CTNAG 3 cut(s) 63, 90, 318
BstDSI CCRYGG 4 cut(s) 133, 160, 235, 262
BstEII GGTNACC 2 cut(s) 128, 230
BstENI CCTNNNNNAGG 1 cut(s) 89
BstKTI GATC 2 cut(s) 145, 247
BstMAI GTCTC 3 cut(s) 73, 200, 302
BstMBI GATC 2 cut(s) 142, 244
BstPI GGTNACC 2 cut(s) 128, 230
BsuRI GGCC 2 cut(s) 159, 261
BtgI CCRYGG 4 cut(s) 133, 160, 235, 262
BtsIMutI CAGTG 2 cut(s) 120, 222
Cfr13I GGNCC 2 cut(s) 191, 293
CviJI RGCY 7 cut(s) 74, 89, 95, 116, 159, 218, 261
CviKI_1 RGCY 7 cut(s) 74, 89, 95, 116, 159, 218, 261
DdeI CTNAG 3 cut(s) 63, 90, 318
DpnI GATC 2 cut(s) 144, 246
DpnII GATC 2 cut(s) 142, 244
EaeI YGGCCR 2 cut(s) 157, 259
Eco130I CCWWGG 3 cut(s) 160, 235, 262
Eco31I GGTCTC 1 cut(s) 73
Eco47I GGWCC 2 cut(s) 191, 293
Eco91I GGTNACC 2 cut(s) 128, 230
EcoNI CCTNNNNNAGG 1 cut(s) 89
EcoO65I GGTNACC 2 cut(s) 128, 230
EcoT14I CCWWGG 3 cut(s) 160, 235, 262
ErhI CCWWGG 3 cut(s) 160, 235, 262
Fnu4HI GCNGC 2 cut(s) 157, 259
Fsp4HI GCNGC 2 cut(s) 157, 259
FspBI CTAG 2 cut(s) 86, 325
GluI GCNGC 2 cut(s) 157, 259
HaeIII GGCC 2 cut(s) 159, 261
Hpy166II GTNNAC 1 cut(s) 176
Hpy188III TCNNGA 1 cut(s) 80
Hpy8I GTNNAC 1 cut(s) 176
HpyCH4III ACNGT 2 cut(s) 128, 230
HpyF3I CTNAG 3 cut(s) 63, 90, 318
Kzo9I GATC 2 cut(s) 142, 244
MaeI CTAG 2 cut(s) 86, 325
MaeIII GTNAC 3 cut(s) 80, 128, 230
MalI GATC 2 cut(s) 144, 246
MboI GATC 2 cut(s) 142, 244
MboII GAAGA 1 cut(s) 14
MslI CAYNNNNRTG 4 cut(s) 144, 150, 246, 252
Mva1269I GAATGC 1 cut(s) 5
NcoI CCATGG 3 cut(s) 160, 235, 262
NdeII GATC 2 cut(s) 142, 244
NmeAIII GCCGAG 1 cut(s) 50
NmuCI GTSAC 1 cut(s) 80
PctI GAATGC 1 cut(s) 5
PkrI GCNGC 2 cut(s) 158, 260
PspEI GGTNACC 2 cut(s) 128, 230
PspPI GGNCC 2 cut(s) 191, 293
RseI CAYNNNNRTG 4 cut(s) 144, 150, 246, 252
SatI GCNGC 2 cut(s) 157, 259
Sau3AI GATC 2 cut(s) 142, 244
Sau96I GGNCC 2 cut(s) 191, 293
SetI ASST 5 cut(s) 69, 87, 91, 196, 298
SinI GGWCC 2 cut(s) 191, 293
SmiMI CAYNNNNRTG 4 cut(s) 144, 150, 246, 252
SsiI CCGC 2 cut(s) 156, 258
SspMI CTAG 2 cut(s) 86, 325
StyI CCWWGG 3 cut(s) 160, 235, 262
TaaI ACNGT 2 cut(s) 128, 230
TauI GCSGC 2 cut(s) 159, 261
TscAI CASTG 2 cut(s) 127, 229
TseFI GTSAC 1 cut(s) 80
Tsp45I GTSAC 1 cut(s) 80
TspGWI ACGGA 2 cut(s) 150, 288
TspRI CASTG 2 cut(s) 127, 229
VpaK11BI GGWCC 2 cut(s) 191, 293
XagI CCTNNNNNAGG 1 cut(s) 89
XcmI CCANNNNNNNNNTGG 1 cut(s) 167
XspI CTAG 2 cut(s) 86, 325
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.