Rmu_sc0003498.1_g000013

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003498.1
OG0000866
Physical Location & Seq
Reverse (-)
48541 .. 48884
344 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003498.1_g000013.1.cds

Sequence Viewer

Length: 234 bp
atggcattctcaaagacttttcttcttgtcgcccttgcctttgctgttctcctcatctctgctaaggtctcggctcatcgtgacctagctgaggctgccactactactcaaaaagccaacactgacggttaccatggacacgatcatggacatggcggccatggaggacatggaggacacggaggacatggaggacatggacctcatgctgttgagactgaaactgagaactag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

77

Amino Acids

7.86

Weight (kDa)

6.38

Isoelectric Point (pI)

11.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 156
AcoI YGGCCR 1 cut(s) 157
AfiI CCNNNNNNNGG 1 cut(s) 91
AluBI AGCT 1 cut(s) 89
AluI AGCT 1 cut(s) 89
Alw26I GTCTC 2 cut(s) 73, 209
AoxI GGCC 1 cut(s) 157
ApeKI GCWGC 1 cut(s) 95
AspS9I GGNCC 1 cut(s) 200
AvaII GGWCC 1 cut(s) 200
BbvCI CCTCAGC 1 cut(s) 90
BbvI GCAGC 1 cut(s) 82
BcoDI GTCTC 2 cut(s) 73, 209
BfaI CTAG 2 cut(s) 86, 232
BisI GCNGC 2 cut(s) 96, 157
BlsI GCNGC 2 cut(s) 97, 158
Bme18I GGWCC 1 cut(s) 200
BmgT120I GGNCC 1 cut(s) 200
Bpu10I CCTNAGC 2 cut(s) 63, 90
BsaI GGTCTC 1 cut(s) 73
BsaJI CCNNGG 2 cut(s) 133, 160
Bsc4I CCNNNNNNNGG 1 cut(s) 91
BseDI CCNNGG 2 cut(s) 133, 160
BseLI CCNNNNNNNGG 1 cut(s) 91
BseMII CTCAG 2 cut(s) 81, 216
BseRI GAGGAG 1 cut(s) 41
BseXI GCAGC 1 cut(s) 82
BshFI GGCC 1 cut(s) 159
BslI CCNNNNNNNGG 1 cut(s) 91
BsmAI GTCTC 2 cut(s) 73, 209
BsmI GAATGC 1 cut(s) 5
BsnI GGCC 1 cut(s) 159
Bso31I GGTCTC 1 cut(s) 73
Bsp143I GATC 1 cut(s) 142
Bsp19I CCATGG 2 cut(s) 133, 160
BspACI CCGC 1 cut(s) 156
BspANI GGCC 1 cut(s) 159
BspCNI CTCAG 2 cut(s) 82, 217
BspTNI GGTCTC 1 cut(s) 73
BssECI CCNNGG 2 cut(s) 133, 160
BssMI GATC 1 cut(s) 142
BssT1I CCWWGG 2 cut(s) 133, 160
Bst4CI ACNGT 1 cut(s) 128
BstDEI CTNAG 3 cut(s) 63, 90, 225
BstDSI CCRYGG 2 cut(s) 133, 160
BstEII GGTNACC 1 cut(s) 128
BstENI CCTNNNNNAGG 1 cut(s) 89
BstKTI GATC 1 cut(s) 145
BstMAI GTCTC 2 cut(s) 73, 209
BstMBI GATC 1 cut(s) 142
BstMWI GCNNNNNNNGC 1 cut(s) 95
BstPI GGTNACC 1 cut(s) 128
BstV1I GCAGC 1 cut(s) 82
BsuRI GGCC 1 cut(s) 159
BtgI CCRYGG 2 cut(s) 133, 160
BtsIMutI CAGTG 1 cut(s) 120
Cfr13I GGNCC 1 cut(s) 200
CviAII CATG 8 cut(s) 134, 146, 152, 161, 170, 188, 197, 206
CviJI RGCY 5 cut(s) 74, 89, 95, 116, 159
CviKI_1 RGCY 5 cut(s) 74, 89, 95, 116, 159
DdeI CTNAG 3 cut(s) 63, 90, 225
DpnI GATC 1 cut(s) 144
DpnII GATC 1 cut(s) 142
EaeI YGGCCR 1 cut(s) 157
Eco130I CCWWGG 2 cut(s) 133, 160
Eco31I GGTCTC 1 cut(s) 73
Eco47I GGWCC 1 cut(s) 200
Eco91I GGTNACC 1 cut(s) 128
EcoNI CCTNNNNNAGG 1 cut(s) 89
EcoO65I GGTNACC 1 cut(s) 128
EcoT14I CCWWGG 2 cut(s) 133, 160
ErhI CCWWGG 2 cut(s) 133, 160
FaeI CATG 8 cut(s) 137, 149, 155, 164, 173, 191, 200, 209
FaiI YATR 8 cut(s) 135, 147, 153, 162, 171, 189, 198, 207
FatI CATG 8 cut(s) 133, 145, 151, 160, 169, 187, 196, 205
Fnu4HI GCNGC 2 cut(s) 96, 157
Fsp4HI GCNGC 2 cut(s) 96, 157
FspBI CTAG 2 cut(s) 86, 232
GluI GCNGC 2 cut(s) 96, 157
HaeIII GGCC 1 cut(s) 159
Hin1II CATG 8 cut(s) 137, 149, 155, 164, 173, 191, 200, 209
Hpy188III TCNNGA 1 cut(s) 80
HpyCH4III ACNGT 1 cut(s) 128
HpyF10VI GCNNNNNNNGC 1 cut(s) 95
HpyF3I CTNAG 3 cut(s) 63, 90, 225
Hsp92II CATG 8 cut(s) 137, 149, 155, 164, 173, 191, 200, 209
Kzo9I GATC 1 cut(s) 142
Lsp1109I GCAGC 1 cut(s) 82
MaeI CTAG 2 cut(s) 86, 232
MaeIII GTNAC 2 cut(s) 80, 128
MalI GATC 1 cut(s) 144
MboI GATC 1 cut(s) 142
MboII GAAGA 1 cut(s) 14
MnlI CCTC 7 cut(s) 62, 85, 158, 167, 176, 185, 213
MslI CAYNNNNRTG 2 cut(s) 144, 150
Mva1269I GAATGC 1 cut(s) 5
MwoI GCNNNNNNNGC 1 cut(s) 95
NcoI CCATGG 2 cut(s) 133, 160
NdeII GATC 1 cut(s) 142
NlaIII CATG 8 cut(s) 137, 149, 155, 164, 173, 191, 200, 209
NmeAIII GCCGAG 1 cut(s) 50
NmuCI GTSAC 1 cut(s) 80
PctI GAATGC 1 cut(s) 5
PkrI GCNGC 2 cut(s) 97, 158
PspEI GGTNACC 1 cut(s) 128
PspPI GGNCC 1 cut(s) 200
RseI CAYNNNNRTG 2 cut(s) 144, 150
SatI GCNGC 2 cut(s) 96, 157
Sau3AI GATC 1 cut(s) 142
Sau96I GGNCC 1 cut(s) 200
SetI ASST 4 cut(s) 69, 87, 91, 205
SinI GGWCC 1 cut(s) 200
SmiMI CAYNNNNRTG 2 cut(s) 144, 150
SsiI CCGC 1 cut(s) 156
SspMI CTAG 2 cut(s) 86, 232
StyI CCWWGG 2 cut(s) 133, 160
TaaI ACNGT 1 cut(s) 128
TauI GCSGC 1 cut(s) 159
TscAI CASTG 1 cut(s) 127
TseFI GTSAC 1 cut(s) 80
TseI GCWGC 1 cut(s) 95
Tsp45I GTSAC 1 cut(s) 80
TspGWI ACGGA 1 cut(s) 195
TspRI CASTG 1 cut(s) 127
VpaK11BI GGWCC 1 cut(s) 200
XagI CCTNNNNNAGG 1 cut(s) 89
XcmI CCANNNNNNNNNTGG 1 cut(s) 167
XspI CTAG 2 cut(s) 86, 232
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.