Rroxscaffold_4G00315370

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
OG0000866
Physical Location & Seq
Forward (+)
39653310 .. 39653719
410 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00315370.1

Sequence Viewer

Length: 300 bp
ATGGCATTCTCAAAGACTTTTCTTCTTGTCGCCCTTGCCTTTGCTGTTCTCCTCATCTCTGCTGAGGTCTCGGCTCATCGTGACCTAGCTGAGGCTACCACTACTACTCAAAAAGCCAACACTGACGGTTACCACGGACACGATCATGGACATGGCGGCTATGGAGGCGGAGGATATGGACATGGAGGCGGTGGATATGGACATGGAGGACATGGTGGAGGCGGAGGATATGGACATGGAGGACATGGTGGAGGCGGAGGACATGGACCTCATGCTGTTGAGACTGAAACTGAGAACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

99

Amino Acids

9.65

Weight (kDa)

6.13

Isoelectric Point (pI)

19.1

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
GRP PF07172 1 - 88 3e-12 Glycine rich protein family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 5 cut(s) 156, 168, 189, 222, 255
AfiI CCNNNNNNNGG 1 cut(s) 91
AluBI AGCT 1 cut(s) 89
AluI AGCT 1 cut(s) 89
Alw26I GTCTC 2 cut(s) 73, 275
AspS9I GGNCC 1 cut(s) 266
AvaII GGWCC 1 cut(s) 266
BbvCI CCTCAGC 2 cut(s) 63, 90
BcoDI GTCTC 2 cut(s) 73, 275
BfaI CTAG 2 cut(s) 86, 298
BisI GCNGC 1 cut(s) 157
BlsI GCNGC 1 cut(s) 158
Bme18I GGWCC 1 cut(s) 266
BmgT120I GGNCC 1 cut(s) 266
Bpu10I CCTNAGC 2 cut(s) 63, 90
BsaI GGTCTC 1 cut(s) 73
BsaJI CCNNGG 1 cut(s) 133
Bsc4I CCNNNNNNNGG 1 cut(s) 91
BseDI CCNNGG 1 cut(s) 133
BseLI CCNNNNNNNGG 1 cut(s) 91
BseMII CTCAG 3 cut(s) 54, 81, 282
BseRI GAGGAG 1 cut(s) 41
BslI CCNNNNNNNGG 1 cut(s) 91
BsmAI GTCTC 2 cut(s) 73, 275
BsmI GAATGC 1 cut(s) 5
Bso31I GGTCTC 1 cut(s) 73
Bsp143I GATC 1 cut(s) 142
BspACI CCGC 5 cut(s) 156, 168, 189, 222, 255
BspCNI CTCAG 3 cut(s) 55, 82, 283
BspTNI GGTCTC 1 cut(s) 73
BssECI CCNNGG 1 cut(s) 133
BssMI GATC 1 cut(s) 142
Bst4CI ACNGT 1 cut(s) 128
BstDEI CTNAG 3 cut(s) 63, 90, 291
BstDSI CCRYGG 1 cut(s) 133
BstEII GGTNACC 1 cut(s) 128
BstENI CCTNNNNNAGG 1 cut(s) 89
BstKTI GATC 1 cut(s) 145
BstMAI GTCTC 2 cut(s) 73, 275
BstMBI GATC 1 cut(s) 142
BstMWI GCNNNNNNNGC 1 cut(s) 165
BstPI GGTNACC 1 cut(s) 128
BtgI CCRYGG 1 cut(s) 133
BtsIMutI CAGTG 1 cut(s) 120
Cfr13I GGNCC 1 cut(s) 266
CviAII CATG 9 cut(s) 146, 152, 182, 203, 212, 236, 245, 263, 272
CviJI RGCY 5 cut(s) 74, 89, 95, 116, 159
CviKI_1 RGCY 5 cut(s) 74, 89, 95, 116, 159
DdeI CTNAG 3 cut(s) 63, 90, 291
DpnI GATC 1 cut(s) 144
DpnII GATC 1 cut(s) 142
EciI GGCGGA 3 cut(s) 183, 237, 270
Eco31I GGTCTC 1 cut(s) 73
Eco47I GGWCC 1 cut(s) 266
Eco91I GGTNACC 1 cut(s) 128
EcoNI CCTNNNNNAGG 1 cut(s) 89
EcoO65I GGTNACC 1 cut(s) 128
FaeI CATG 9 cut(s) 149, 155, 185, 206, 215, 239, 248, 266, 275
FatI CATG 9 cut(s) 145, 151, 181, 202, 211, 235, 244, 262, 271
Fnu4HI GCNGC 1 cut(s) 157
Fsp4HI GCNGC 1 cut(s) 157
FspBI CTAG 2 cut(s) 86, 298
GluI GCNGC 1 cut(s) 157
Hin1II CATG 9 cut(s) 149, 155, 185, 206, 215, 239, 248, 266, 275
Hpy188III TCNNGA 1 cut(s) 80
HpyCH4III ACNGT 1 cut(s) 128
HpyF10VI GCNNNNNNNGC 1 cut(s) 165
HpyF3I CTNAG 3 cut(s) 63, 90, 291
Hsp92II CATG 9 cut(s) 149, 155, 185, 206, 215, 239, 248, 266, 275
Kzo9I GATC 1 cut(s) 142
MaeI CTAG 2 cut(s) 86, 298
MaeIII GTNAC 2 cut(s) 80, 128
MalI GATC 1 cut(s) 144
MboI GATC 1 cut(s) 142
MboII GAAGA 1 cut(s) 14
MslI CAYNNNNRTG 2 cut(s) 144, 150
Mva1269I GAATGC 1 cut(s) 5
MwoI GCNNNNNNNGC 1 cut(s) 165
NdeII GATC 1 cut(s) 142
NlaIII CATG 9 cut(s) 149, 155, 185, 206, 215, 239, 248, 266, 275
NmeAIII GCCGAG 1 cut(s) 50
NmuCI GTSAC 1 cut(s) 80
PctI GAATGC 1 cut(s) 5
PkrI GCNGC 1 cut(s) 158
PspEI GGTNACC 1 cut(s) 128
PspPI GGNCC 1 cut(s) 266
RseI CAYNNNNRTG 2 cut(s) 144, 150
SatI GCNGC 1 cut(s) 157
Sau3AI GATC 1 cut(s) 142
Sau96I GGNCC 1 cut(s) 266
SetI ASST 4 cut(s) 69, 87, 91, 271
SinI GGWCC 1 cut(s) 266
SmiMI CAYNNNNRTG 2 cut(s) 144, 150
SsiI CCGC 5 cut(s) 156, 168, 189, 222, 255
SspMI CTAG 2 cut(s) 86, 298
TaaI ACNGT 1 cut(s) 128
TauI GCSGC 1 cut(s) 159
TscAI CASTG 1 cut(s) 127
TseFI GTSAC 1 cut(s) 80
Tsp45I GTSAC 1 cut(s) 80
TspGWI ACGGA 1 cut(s) 150
TspRI CASTG 1 cut(s) 127
VpaK11BI GGWCC 1 cut(s) 266
XagI CCTNNNNNAGG 1 cut(s) 89
XspI CTAG 2 cut(s) 86, 298
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.