RchiOBHm_Chr3g0478901

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
OG0000866
Physical Location & Seq
Reverse (-)
24568184 .. 24568873
690 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ44405

Sequence Viewer

Length: 261 bp
ATGGCATTCTCAAAGACTTTTCTTCTTGTCGCCCTCGCCTTCGCTGTTCTCCTCATCTCTGCTGAGGTCTCGGCTCATCGTAACCTAGCTGAGACTACCACTACTACTCAAGAAGCCAACACTGACGGTCACCACGGACACGATCATGGACATGGCGGCCATGGAGGACATGGTGGACACGGAGGACATGGTGGACACGGAGGTCATGGAGGTCATGGAGGACATGGACCTCATGCTGTTGAGACTGAAACTGAGAACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

86

Amino Acids

8.65

Weight (kDa)

6.16

Isoelectric Point (pI)

16.27

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
GRP PF07172 1 - 75 1.9e-11 Glycine rich protein family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 201
AciI CCGC 1 cut(s) 156
AcoI YGGCCR 1 cut(s) 157
AluBI AGCT 1 cut(s) 89
AluI AGCT 1 cut(s) 89
Alw26I GTCTC 3 cut(s) 73, 86, 236
AoxI GGCC 1 cut(s) 157
AspS9I GGNCC 1 cut(s) 227
AsuHPI GGTGA 1 cut(s) 122
AvaII GGWCC 1 cut(s) 227
BbvCI CCTCAGC 1 cut(s) 63
BcoDI GTCTC 3 cut(s) 73, 86, 236
BfaI CTAG 2 cut(s) 86, 259
BisI GCNGC 1 cut(s) 157
BlsI GCNGC 1 cut(s) 158
Bme18I GGWCC 1 cut(s) 227
BmgT120I GGNCC 1 cut(s) 227
Bpu10I CCTNAGC 1 cut(s) 63
BpuEI CTTGAG 1 cut(s) 93
BsaI GGTCTC 1 cut(s) 73
BsaJI CCNNGG 2 cut(s) 133, 160
BseDI CCNNGG 2 cut(s) 133, 160
BseMII CTCAG 3 cut(s) 54, 81, 243
BseRI GAGGAG 1 cut(s) 41
BshFI GGCC 1 cut(s) 159
BsmAI GTCTC 3 cut(s) 73, 86, 236
BsmI GAATGC 1 cut(s) 5
BsnI GGCC 1 cut(s) 159
Bso31I GGTCTC 1 cut(s) 73
Bsp143I GATC 1 cut(s) 142
Bsp19I CCATGG 1 cut(s) 160
BspACI CCGC 1 cut(s) 156
BspANI GGCC 1 cut(s) 159
BspCNI CTCAG 3 cut(s) 55, 82, 244
BspTNI GGTCTC 1 cut(s) 73
BssECI CCNNGG 2 cut(s) 133, 160
BssMI GATC 1 cut(s) 142
BssT1I CCWWGG 1 cut(s) 160
Bst4CI ACNGT 1 cut(s) 128
BstDEI CTNAG 3 cut(s) 63, 90, 252
BstDSI CCRYGG 2 cut(s) 133, 160
BstEII GGTNACC 1 cut(s) 128
BstKTI GATC 1 cut(s) 145
BstMAI GTCTC 3 cut(s) 73, 86, 236
BstMBI GATC 1 cut(s) 142
BstPI GGTNACC 1 cut(s) 128
BsuRI GGCC 1 cut(s) 159
BtgI CCRYGG 2 cut(s) 133, 160
BtsIMutI CAGTG 1 cut(s) 120
Cfr13I GGNCC 1 cut(s) 227
CviAII CATG 9 cut(s) 146, 152, 161, 170, 188, 206, 215, 224, 233
CviJI RGCY 4 cut(s) 74, 89, 116, 159
CviKI_1 RGCY 4 cut(s) 74, 89, 116, 159
DdeI CTNAG 3 cut(s) 63, 90, 252
DpnI GATC 1 cut(s) 144
DpnII GATC 1 cut(s) 142
DrdI GACNNNNNNGTC 1 cut(s) 201
DseDI GACNNNNNNGTC 1 cut(s) 201
EaeI YGGCCR 1 cut(s) 157
Eco130I CCWWGG 1 cut(s) 160
Eco31I GGTCTC 1 cut(s) 73
Eco47I GGWCC 1 cut(s) 227
Eco91I GGTNACC 1 cut(s) 128
EcoO65I GGTNACC 1 cut(s) 128
EcoT14I CCWWGG 1 cut(s) 160
ErhI CCWWGG 1 cut(s) 160
FaeI CATG 9 cut(s) 149, 155, 164, 173, 191, 209, 218, 227, 236
FaiI YATR 9 cut(s) 147, 153, 162, 171, 189, 207, 216, 225, 234
FatI CATG 9 cut(s) 145, 151, 160, 169, 187, 205, 214, 223, 232
Fnu4HI GCNGC 1 cut(s) 157
Fsp4HI GCNGC 1 cut(s) 157
FspBI CTAG 2 cut(s) 86, 259
GluI GCNGC 1 cut(s) 157
HaeIII GGCC 1 cut(s) 159
Hin1II CATG 9 cut(s) 149, 155, 164, 173, 191, 209, 218, 227, 236
HphI GGTGA 1 cut(s) 122
Hpy166II GTNNAC 2 cut(s) 176, 194
Hpy188III TCNNGA 1 cut(s) 110
Hpy8I GTNNAC 2 cut(s) 176, 194
HpyAV CCTTC 1 cut(s) 49
HpyCH4III ACNGT 1 cut(s) 128
HpyF3I CTNAG 3 cut(s) 63, 90, 252
Hsp92II CATG 9 cut(s) 149, 155, 164, 173, 191, 209, 218, 227, 236
Kzo9I GATC 1 cut(s) 142
MaeI CTAG 2 cut(s) 86, 259
MaeIII GTNAC 2 cut(s) 80, 128
MalI GATC 1 cut(s) 144
MboI GATC 1 cut(s) 142
MboII GAAGA 1 cut(s) 14
MnlI CCTC 9 cut(s) 44, 58, 62, 158, 176, 194, 203, 212, 240
MslI CAYNNNNRTG 2 cut(s) 144, 150
Mva1269I GAATGC 1 cut(s) 5
NcoI CCATGG 1 cut(s) 160
NdeII GATC 1 cut(s) 142
NlaIII CATG 9 cut(s) 149, 155, 164, 173, 191, 209, 218, 227, 236
NmeAIII GCCGAG 1 cut(s) 50
NmuCI GTSAC 1 cut(s) 128
PctI GAATGC 1 cut(s) 5
PkrI GCNGC 1 cut(s) 158
PspEI GGTNACC 1 cut(s) 128
PspPI GGNCC 1 cut(s) 227
RseI CAYNNNNRTG 2 cut(s) 144, 150
SatI GCNGC 1 cut(s) 157
Sau3AI GATC 1 cut(s) 142
Sau96I GGNCC 1 cut(s) 227
SetI ASST 6 cut(s) 69, 87, 91, 205, 214, 232
SinI GGWCC 1 cut(s) 227
SmiMI CAYNNNNRTG 2 cut(s) 144, 150
SmlI CTYRAG 1 cut(s) 108
SmoI CTYRAG 1 cut(s) 108
SsiI CCGC 1 cut(s) 156
SspMI CTAG 2 cut(s) 86, 259
StyI CCWWGG 1 cut(s) 160
TaaI ACNGT 1 cut(s) 128
TauI GCSGC 1 cut(s) 159
TscAI CASTG 1 cut(s) 127
TseFI GTSAC 1 cut(s) 128
Tsp45I GTSAC 1 cut(s) 128
TspGWI ACGGA 3 cut(s) 150, 195, 213
TspRI CASTG 1 cut(s) 127
VpaK11BI GGWCC 1 cut(s) 227
XcmI CCANNNNNNNNNTGG 1 cut(s) 167
XspI CTAG 2 cut(s) 86, 259
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.