Rh3BG252600

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
Physical Location & Seq
Reverse (-)
24406745 .. 24407756
1012 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG252600.1

Sequence Viewer

Length: 384 bp
ATGCGCAAAAAGAAAAGGAAAAGAAAGAAATTAAACTGTGGGTCTCACAAATTGATCCCTCTTTCTCACTCGCTCACTCCTCTCCCACGTACTCGATCACTCTTCGAGGCCAAGAAGTCTATAAATAGGGAGGGCCAAGCTTCAGGAACTTCACTCAGAAATCAATCACCTCTTGCATACCTTCCTACAAACTCTAAGCAATCAAGAGAGATCGAGATGGCATTCTCAAAGACTTTTCTTCTTGTCGCCCTCGCCTTCGCTGTTCTCCTCATCTCTGCTGAGGTCTCGGCTCATCGTAACCTAGCTGAGACTACCACTACTACTCGTGAGTTTCTCACTTTCTTAATCAACCAGTGTAGAATTACATTCTATAATTCAACTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

127

Amino Acids

14.4

Weight (kDa)

10.83

Isoelectric Point (pI)

44.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 5
AclWI GGATC 1 cut(s) 49
AcuI CTGAAG 1 cut(s) 126
AfaI GTAC 1 cut(s) 91
AgsI TTSAA 1 cut(s) 378
AluBI AGCT 2 cut(s) 140, 305
AluI AGCT 2 cut(s) 140, 305
Alw26I GTCTC 3 cut(s) 48, 289, 302
AlwI GGATC 1 cut(s) 49
AoxI GGCC 2 cut(s) 108, 133
AspLEI GCGC 1 cut(s) 6
AspS9I GGNCC 1 cut(s) 133
AsuHPI GGTGA 1 cut(s) 159
BauI CACGAG 1 cut(s) 324
BbvCI CCTCAGC 1 cut(s) 279
BccI CCATC 1 cut(s) 211
BcoDI GTCTC 3 cut(s) 48, 289, 302
BfaI CTAG 1 cut(s) 302
BmgT120I GGNCC 1 cut(s) 133
Bpu10I CCTNAGC 1 cut(s) 279
BsaAI YACGTR 1 cut(s) 89
BsaI GGTCTC 2 cut(s) 48, 289
Bse1I ACTGG 1 cut(s) 352
BseMII CTCAG 3 cut(s) 169, 270, 297
BseNI ACTGG 1 cut(s) 352
BseRI GAGGAG 2 cut(s) 69, 257
BshFI GGCC 2 cut(s) 110, 135
BsmAI GTCTC 3 cut(s) 48, 289, 302
BsmI GAATGC 1 cut(s) 221
BsnI GGCC 2 cut(s) 110, 135
Bso31I GGTCTC 2 cut(s) 48, 289
Bsp143I GATC 3 cut(s) 54, 95, 210
BspANI GGCC 2 cut(s) 110, 135
BspCNI CTCAG 3 cut(s) 168, 271, 298
BspPI GGATC 1 cut(s) 49
BspTNI GGTCTC 2 cut(s) 48, 289
BsrI ACTGG 1 cut(s) 352
BssMI GATC 3 cut(s) 54, 95, 210
BssSI CACGAG 1 cut(s) 324
Bst2BI CACGAG 1 cut(s) 324
Bst4CI ACNGT 1 cut(s) 38
Bst6I CTCTTC 1 cut(s) 107
BstBAI YACGTR 1 cut(s) 89
BstDEI CTNAG 4 cut(s) 155, 195, 279, 306
BstHHI GCGC 1 cut(s) 6
BstKTI GATC 3 cut(s) 57, 98, 213
BstMAI GTCTC 3 cut(s) 48, 289, 302
BstMBI GATC 3 cut(s) 54, 95, 210
BsuRI GGCC 2 cut(s) 110, 135
BtsIMutI CAGTG 1 cut(s) 359
CfoI GCGC 1 cut(s) 6
Cfr13I GGNCC 1 cut(s) 133
Csp6I GTAC 1 cut(s) 90
CviJI RGCY 5 cut(s) 110, 135, 140, 290, 305
CviKI_1 RGCY 5 cut(s) 110, 135, 140, 290, 305
CviQI GTAC 1 cut(s) 90
DdeI CTNAG 4 cut(s) 155, 195, 279, 306
DpnI GATC 3 cut(s) 56, 97, 212
DpnII GATC 3 cut(s) 54, 95, 210
Eam1104I CTCTTC 1 cut(s) 107
EarI CTCTTC 1 cut(s) 107
Eco31I GGTCTC 2 cut(s) 48, 289
Eco57I CTGAAG 1 cut(s) 126
FaiI YATR 3 cut(s) 122, 178, 372
FspBI CTAG 1 cut(s) 302
FspI TGCGCA 1 cut(s) 5
GlaI GCGC 1 cut(s) 5
HaeIII GGCC 2 cut(s) 110, 135
HhaI GCGC 1 cut(s) 6
Hin6I GCGC 1 cut(s) 4
HinP1I GCGC 1 cut(s) 4
HindIII AAGCTT 1 cut(s) 138
HphI GGTGA 1 cut(s) 159
Hpy188I TCNGA 1 cut(s) 158
Hpy188III TCNNGA 4 cut(s) 144, 204, 214, 326
HpyAV CCTTC 2 cut(s) 191, 265
HpyCH4III ACNGT 1 cut(s) 38
HpyCH4IV ACGT 1 cut(s) 88
HpyCH4V TGCA 1 cut(s) 176
HpyF3I CTNAG 4 cut(s) 155, 195, 279, 306
HpySE526I ACGT 1 cut(s) 88
HspAI GCGC 1 cut(s) 4
Kzo9I GATC 3 cut(s) 54, 95, 210
LpnPI CCDG 2 cut(s) 129, 365
MaeI CTAG 1 cut(s) 302
MaeII ACGT 1 cut(s) 88
MaeIII GTNAC 1 cut(s) 296
MalI GATC 3 cut(s) 56, 97, 212
MboI GATC 3 cut(s) 54, 95, 210
MboII GAAGA 2 cut(s) 94, 230
MluCI AATT 4 cut(s) 29, 50, 360, 373
MnlI CCTC 8 cut(s) 69, 90, 100, 124, 180, 260, 274, 278
MseI TTAA 3 cut(s) 32, 344, 382
Mva1269I GAATGC 1 cut(s) 221
NdeII GATC 3 cut(s) 54, 95, 210
NmeAIII GCCGAG 1 cut(s) 266
NsbI TGCGCA 1 cut(s) 5
PctI GAATGC 1 cut(s) 221
Ppu21I YACGTR 1 cut(s) 89
PspPI GGNCC 1 cut(s) 133
RsaI GTAC 1 cut(s) 91
RsaNI GTAC 1 cut(s) 90
SaqAI TTAA 3 cut(s) 32, 344, 382
Sau3AI GATC 3 cut(s) 54, 95, 210
Sau96I GGNCC 1 cut(s) 133
SetI ASST 7 cut(s) 91, 142, 172, 183, 285, 303, 307
Sse9I AATT 4 cut(s) 29, 50, 360, 373
SspMI CTAG 1 cut(s) 302
TaaI ACNGT 1 cut(s) 38
TaiI ACGT 1 cut(s) 91
TaqI TCGA 3 cut(s) 94, 105, 213
TasI AATT 4 cut(s) 29, 50, 360, 373
Tru1I TTAA 3 cut(s) 32, 344, 382
Tru9I TTAA 3 cut(s) 32, 344, 382
TscAI CASTG 1 cut(s) 359
TspRI CASTG 1 cut(s) 359
XspI CTAG 1 cut(s) 302
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.