Rroxscaffold_4G00315380

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
OG0000866
Physical Location & Seq
Forward (+)
39666185 .. 39666802
618 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00315380.1

Sequence Viewer

Length: 231 bp
ATGGCGTACTCAAAGACTATTCTTCTTGTTGTCTTTGCCGTTCTCCTCATCACTGCTGAGGTCTCAGCTCATCGTGACCTAACTAAGACAACCACTCTAACTACTGATGGTAGCGAGGCATACAATAGAGGAGGCAATGGAGGAAATGGAGGAGGCAAGGGAGGAAATGGCGGCAATGGAGGAAAGGGAGGAAAGGGAGGGGGCGGGCATGGACCCGAAATCGAGAACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

76

Amino Acids

7.42

Weight (kDa)

8.11

Isoelectric Point (pI)

22.34

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
GRP PF07172 1 - 71 4.2e-09 Glycine rich protein family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 171, 204
AfaI GTAC 1 cut(s) 8
AluBI AGCT 1 cut(s) 68
AluI AGCT 1 cut(s) 68
Alw26I GTCTC 1 cut(s) 67
AspS9I GGNCC 1 cut(s) 212
AvaII GGWCC 1 cut(s) 212
BbvCI CCTCAGC 1 cut(s) 57
BccI CCATC 1 cut(s) 101
BceAI ACGGC 1 cut(s) 23
BcoDI GTCTC 1 cut(s) 67
BfaI CTAG 1 cut(s) 229
BisI GCNGC 1 cut(s) 172
BlsI GCNGC 1 cut(s) 173
Bme18I GGWCC 1 cut(s) 212
BmgT120I GGNCC 1 cut(s) 212
BmiI GGNNCC 1 cut(s) 214
Bpu10I CCTNAGC 1 cut(s) 57
BsaI GGTCTC 1 cut(s) 67
Bse3DI GCAATG 2 cut(s) 142, 181
BseMI GCAATG 2 cut(s) 142, 181
BseMII CTCAG 2 cut(s) 48, 78
BseRI GAGGAG 3 cut(s) 35, 144, 165
BsmAI GTCTC 1 cut(s) 67
Bso31I GGTCTC 1 cut(s) 67
BspACI CCGC 2 cut(s) 171, 204
BspCNI CTCAG 2 cut(s) 49, 77
BspLI GGNNCC 1 cut(s) 214
BspTNI GGTCTC 1 cut(s) 67
BsrDI GCAATG 2 cut(s) 142, 181
BstC8I GCNNGC 1 cut(s) 206
BstDEI CTNAG 3 cut(s) 57, 64, 84
BstMAI GTCTC 1 cut(s) 67
BtsI GCAGTG 1 cut(s) 51
BtsIMutI CAGTG 1 cut(s) 51
Cac8I GCNNGC 1 cut(s) 206
Cfr13I GGNCC 1 cut(s) 212
Csp6I GTAC 1 cut(s) 7
CviAII CATG 1 cut(s) 209
CviJI RGCY 1 cut(s) 68
CviKI_1 RGCY 1 cut(s) 68
CviQI GTAC 1 cut(s) 7
DdeI CTNAG 3 cut(s) 57, 64, 84
Eco31I GGTCTC 1 cut(s) 67
Eco47I GGWCC 1 cut(s) 212
FaeI CATG 1 cut(s) 212
FaiI YATR 2 cut(s) 121, 210
FatI CATG 1 cut(s) 208
FauI CCCGC 1 cut(s) 197
Fnu4HI GCNGC 1 cut(s) 172
Fsp4HI GCNGC 1 cut(s) 172
FspBI CTAG 1 cut(s) 229
GluI GCNGC 1 cut(s) 172
Hin1II CATG 1 cut(s) 212
Hpy188III TCNNGA 2 cut(s) 74, 223
HpyF3I CTNAG 3 cut(s) 57, 64, 84
Hsp92II CATG 1 cut(s) 212
MaeI CTAG 1 cut(s) 229
MaeIII GTNAC 1 cut(s) 74
MboII GAAGA 1 cut(s) 14
NlaIII CATG 1 cut(s) 212
NlaIV GGNNCC 1 cut(s) 214
NmuCI GTSAC 1 cut(s) 74
PkrI GCNGC 1 cut(s) 173
PspN4I GGNNCC 1 cut(s) 214
PspPI GGNCC 1 cut(s) 212
RsaI GTAC 1 cut(s) 8
RsaNI GTAC 1 cut(s) 7
SatI GCNGC 1 cut(s) 172
Sau96I GGNCC 1 cut(s) 212
SetI ASST 3 cut(s) 63, 70, 81
SgeI CNNG 7 cut(s) 38, 86, 127, 169, 217, 221, 227
SinI GGWCC 1 cut(s) 212
SsiI CCGC 2 cut(s) 171, 204
SspMI CTAG 1 cut(s) 229
TaqI TCGA 1 cut(s) 222
TauI GCSGC 1 cut(s) 174
TscAI CASTG 1 cut(s) 58
TseFI GTSAC 1 cut(s) 74
Tsp45I GTSAC 1 cut(s) 74
TspRI CASTG 1 cut(s) 58
VpaK11BI GGWCC 1 cut(s) 212
XspI CTAG 1 cut(s) 229
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.