Rh5DG295300

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
OG0000866
Physical Location & Seq
Forward (+)
37234548 .. 37245945
11398 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG295300.1

Sequence Viewer

Length: 204 bp
ATGAAAATTCTGACCATTTCCACGGCAACGATCATGGACATGGTGGCCATGGACATGGAGGCGAAGGAGGACAGGGAGGACACGGAGGACATGGTGGCCATGGAGGCCGTGGAGGACACGGAGGGCATGGACCTGGTGCTCATGAAACTGAGAATTAGATACCGTTTGCTGCCTCGCCTAATGTCAGGCGTGCTAGCTGCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

67

Amino Acids

7.61

Weight (kDa)

4.4

Isoelectric Point (pI)

29.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 2 cut(s) 45, 96
AcsI RAATTY 1 cut(s) 6
AjnI CCWGG 1 cut(s) 132
AluBI AGCT 1 cut(s) 197
AluI AGCT 1 cut(s) 197
Alw21I GWGCWC 1 cut(s) 141
AoxI GGCC 3 cut(s) 45, 96, 105
ApeKI GCWGC 2 cut(s) 169, 197
ApoI RAATTY 1 cut(s) 6
AspS9I GGNCC 1 cut(s) 130
AsuNHI GCTAGC 1 cut(s) 193
AvaII GGWCC 1 cut(s) 130
BalI TGGCCA 2 cut(s) 47, 98
Bbv12I GWGCWC 1 cut(s) 141
BbvI GCAGC 2 cut(s) 156, 184
BceAI ACGGC 2 cut(s) 39, 92
BciT130I CCWGG 1 cut(s) 134
BfaI CTAG 1 cut(s) 194
BglI GCCNNNNNGGC 1 cut(s) 104
BisI GCNGC 2 cut(s) 170, 198
BlsI GCNGC 2 cut(s) 171, 199
Bme1390I CCNGG 1 cut(s) 134
Bme18I GGWCC 1 cut(s) 130
BmgT120I GGNCC 1 cut(s) 130
BmrFI CCNGG 1 cut(s) 134
BmtI GCTAGC 1 cut(s) 197
BsaJI CCNNGG 4 cut(s) 21, 48, 99, 108
BseBI CCWGG 1 cut(s) 134
BseDI CCNNGG 4 cut(s) 21, 48, 99, 108
BseMII CTCAG 1 cut(s) 140
BseXI GCAGC 2 cut(s) 156, 184
BshFI GGCC 3 cut(s) 47, 98, 107
BsiHKAI GWGCWC 1 cut(s) 141
BsnI GGCC 3 cut(s) 47, 98, 107
Bsp1286I GDGCHC 1 cut(s) 141
Bsp143I GATC 1 cut(s) 30
Bsp19I CCATGG 2 cut(s) 48, 99
BspANI GGCC 3 cut(s) 47, 98, 107
BspCNI CTCAG 1 cut(s) 141
BspHI TCATGA 1 cut(s) 141
BspOI GCTAGC 1 cut(s) 197
BssECI CCNNGG 4 cut(s) 21, 48, 99, 108
BssMI GATC 1 cut(s) 30
BssT1I CCWWGG 2 cut(s) 48, 99
Bst2UI CCWGG 1 cut(s) 134
Bst4CI ACNGT 1 cut(s) 164
BstC8I GCNNGC 2 cut(s) 191, 195
BstDEI CTNAG 1 cut(s) 149
BstDSI CCRYGG 4 cut(s) 21, 48, 99, 108
BstKTI GATC 1 cut(s) 33
BstMBI GATC 1 cut(s) 30
BstMWI GCNNNNNNNGC 1 cut(s) 104
BstNI CCWGG 1 cut(s) 134
BstSCI CCNGG 1 cut(s) 132
BstV1I GCAGC 2 cut(s) 156, 184
BstXI CCANNNNNNTGG 1 cut(s) 55
BsuRI GGCC 3 cut(s) 47, 98, 107
BtgI CCRYGG 4 cut(s) 21, 48, 99, 108
Cac8I GCNNGC 2 cut(s) 191, 195
CciI TCATGA 1 cut(s) 141
Cfr13I GGNCC 1 cut(s) 130
CsiI ACCWGGT 1 cut(s) 132
CviAII CATG 9 cut(s) 34, 40, 49, 55, 91, 100, 127, 142, 201
CviJI RGCY 4 cut(s) 47, 98, 107, 197
CviKI_1 RGCY 4 cut(s) 47, 98, 107, 197
DdeI CTNAG 1 cut(s) 149
DpnI GATC 1 cut(s) 32
DpnII GATC 1 cut(s) 30
EaeI YGGCCR 2 cut(s) 45, 96
Eco130I CCWWGG 2 cut(s) 48, 99
Eco47I GGWCC 1 cut(s) 130
EcoRII CCWGG 1 cut(s) 132
EcoT14I CCWWGG 2 cut(s) 48, 99
ErhI CCWWGG 2 cut(s) 48, 99
FaeI CATG 9 cut(s) 37, 43, 52, 58, 94, 103, 130, 145, 204
FaiI YATR 9 cut(s) 35, 41, 50, 56, 92, 101, 128, 143, 202
FatI CATG 9 cut(s) 33, 39, 48, 54, 90, 99, 126, 141, 200
Fnu4HI GCNGC 2 cut(s) 170, 198
Fsp4HI GCNGC 2 cut(s) 170, 198
FspBI CTAG 1 cut(s) 194
GluI GCNGC 2 cut(s) 170, 198
HaeIII GGCC 3 cut(s) 47, 98, 107
Hin1II CATG 9 cut(s) 37, 43, 52, 58, 94, 103, 130, 145, 204
Hpy188I TCNGA 1 cut(s) 12
Hpy188III TCNNGA 1 cut(s) 142
HpyAV CCTTC 1 cut(s) 58
HpyCH4III ACNGT 1 cut(s) 164
HpyCH4V TGCA 1 cut(s) 200
HpyF10VI GCNNNNNNNGC 1 cut(s) 104
HpyF3I CTNAG 1 cut(s) 149
Hsp92II CATG 9 cut(s) 37, 43, 52, 58, 94, 103, 130, 145, 204
Kzo9I GATC 1 cut(s) 30
LpnPI CCDG 4 cut(s) 58, 119, 146, 171
Lsp1109I GCAGC 2 cut(s) 156, 184
MabI ACCWGGT 1 cut(s) 132
MaeI CTAG 1 cut(s) 194
MalI GATC 1 cut(s) 32
MboI GATC 1 cut(s) 30
MhlI GDGCHC 1 cut(s) 141
MlsI TGGCCA 2 cut(s) 47, 98
MluCI AATT 2 cut(s) 6, 153
MluNI TGGCCA 2 cut(s) 47, 98
MnlI CCTC 8 cut(s) 52, 61, 70, 79, 97, 106, 115, 183
Mox20I TGGCCA 2 cut(s) 47, 98
MscI TGGCCA 2 cut(s) 47, 98
MslI CAYNNNNRTG 2 cut(s) 38, 53
Msp20I TGGCCA 2 cut(s) 47, 98
MspR9I CCNGG 1 cut(s) 134
MvaI CCWGG 1 cut(s) 134
MwoI GCNNNNNNNGC 1 cut(s) 104
NcoI CCATGG 2 cut(s) 48, 99
NdeII GATC 1 cut(s) 30
NheI GCTAGC 1 cut(s) 193
NlaIII CATG 9 cut(s) 37, 43, 52, 58, 94, 103, 130, 145, 204
PagI TCATGA 1 cut(s) 141
PkrI GCNGC 2 cut(s) 171, 199
Psp6I CCWGG 1 cut(s) 132
PspGI CCWGG 1 cut(s) 132
PspPI GGNCC 1 cut(s) 130
RseI CAYNNNNRTG 2 cut(s) 38, 53
SatI GCNGC 2 cut(s) 170, 198
Sau3AI GATC 1 cut(s) 30
Sau96I GGNCC 1 cut(s) 130
ScrFI CCNGG 1 cut(s) 134
SduI GDGCHC 1 cut(s) 141
SetI ASST 2 cut(s) 135, 199
SexAI ACCWGGT 1 cut(s) 132
SfiI GGCCNNNNNGGCC 1 cut(s) 104
SinI GGWCC 1 cut(s) 130
SmiMI CAYNNNNRTG 2 cut(s) 38, 53
Sse9I AATT 2 cut(s) 6, 153
SspMI CTAG 1 cut(s) 194
StyD4I CCNGG 1 cut(s) 132
StyI CCWWGG 2 cut(s) 48, 99
TaaI ACNGT 1 cut(s) 164
TasI AATT 2 cut(s) 6, 153
TseI GCWGC 2 cut(s) 169, 197
TspDTI ATGAA 2 cut(s) 17, 158
TspGWI ACGGA 2 cut(s) 98, 134
VpaK11BI GGWCC 1 cut(s) 130
XapI RAATTY 1 cut(s) 6
XcmI CCANNNNNNNNNTGG 1 cut(s) 106
XspI CTAG 1 cut(s) 194
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.