Rh1AG157200

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
Physical Location & Seq
Forward (+)
29570452 .. 29571031
580 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG157200.1

Sequence Viewer

Length: 381 bp
ATGGCGTACTCAAAGACTATTCTTCTTGTTGTCTTTGCCGTTCTCCTCATCACTGCTGAGGTCTCAGCTCATCGTGACCTAACTGAGACAACCACTCCAACTATTGATGGTAGCGGGGCATACAATAGAGGAGGCAATGGAGGAAACGGCGGAGGCAAGGGAGGAAACGGAGGATACGGAGGAGGAAGCAATGGAGGAAACGGAGGAGGCAAGGGAGGAAATGGAGGATACGGAGGAGGAAGTAATGGTGGAAACGGAGGTGGCAAAGGAGGAAACGGAGGAGGCAAGGGAGGCAATGGAGGAGGCAAGGGAGGAAATGGTGGAAATGGAGGAAAGGGAGGAAAGGGAGGGGGAGGGCATGGACCCCAAACCGAGAACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

126

Amino Acids

11.19

Weight (kDa)

9.7

Isoelectric Point (pI)

11.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 114, 150
AfaI GTAC 1 cut(s) 8
AluBI AGCT 1 cut(s) 68
AluI AGCT 1 cut(s) 68
Alw26I GTCTC 2 cut(s) 67, 80
AspS9I GGNCC 1 cut(s) 362
AvaII GGWCC 1 cut(s) 362
BbvCI CCTCAGC 1 cut(s) 57
BccI CCATC 1 cut(s) 101
BceAI ACGGC 2 cut(s) 23, 163
BciVI GTATCC 2 cut(s) 167, 221
BcoDI GTCTC 2 cut(s) 67, 80
BfaI CTAG 1 cut(s) 379
BfuI GTATCC 2 cut(s) 167, 221
Bme18I GGWCC 1 cut(s) 362
BmgT120I GGNCC 1 cut(s) 362
BmiI GGNNCC 1 cut(s) 364
Bpu10I CCTNAGC 1 cut(s) 57
BsaI GGTCTC 1 cut(s) 67
BsaXI ACNNNNNCTCC 2 cut(s) 79, 109
Bse3DI GCAATG 3 cut(s) 142, 196, 301
BseMI GCAATG 3 cut(s) 142, 196, 301
BseMII CTCAG 3 cut(s) 48, 75, 78
BseRI GAGGAG 7 cut(s) 35, 144, 195, 219, 249, 294, 315
BsmAI GTCTC 2 cut(s) 67, 80
Bso31I GGTCTC 1 cut(s) 67
BspACI CCGC 2 cut(s) 114, 150
BspCNI CTCAG 3 cut(s) 49, 76, 77
BspLI GGNNCC 1 cut(s) 364
BspTNI GGTCTC 1 cut(s) 67
BsrDI GCAATG 3 cut(s) 142, 196, 301
BstDEI CTNAG 3 cut(s) 57, 64, 84
BstMAI GTCTC 2 cut(s) 67, 80
BstMWI GCNNNNNNNGC 1 cut(s) 291
BsuI GTATCC 2 cut(s) 167, 221
BtsI GCAGTG 1 cut(s) 51
BtsIMutI CAGTG 1 cut(s) 51
Cfr13I GGNCC 1 cut(s) 362
Csp6I GTAC 1 cut(s) 7
CviAII CATG 1 cut(s) 359
CviJI RGCY 1 cut(s) 68
CviKI_1 RGCY 1 cut(s) 68
CviQI GTAC 1 cut(s) 7
DdeI CTNAG 3 cut(s) 57, 64, 84
EciI GGCGGA 1 cut(s) 165
Eco31I GGTCTC 1 cut(s) 67
Eco47I GGWCC 1 cut(s) 362
FaeI CATG 1 cut(s) 362
FaiI YATR 2 cut(s) 121, 360
FatI CATG 1 cut(s) 358
FauI CCCGC 1 cut(s) 107
FspBI CTAG 1 cut(s) 379
Hin1II CATG 1 cut(s) 362
Hpy188III TCNNGA 1 cut(s) 74
HpyF10VI GCNNNNNNNGC 1 cut(s) 291
HpyF3I CTNAG 3 cut(s) 57, 64, 84
Hsp92II CATG 1 cut(s) 362
MaeI CTAG 1 cut(s) 379
MaeIII GTNAC 1 cut(s) 74
MboII GAAGA 1 cut(s) 14
MmeI TCCRAC 1 cut(s) 122
MwoI GCNNNNNNNGC 1 cut(s) 291
NlaIII CATG 1 cut(s) 362
NlaIV GGNNCC 1 cut(s) 364
NmuCI GTSAC 1 cut(s) 74
PspN4I GGNNCC 1 cut(s) 364
PspPI GGNCC 1 cut(s) 362
RsaI GTAC 1 cut(s) 8
RsaNI GTAC 1 cut(s) 7
Sau96I GGNCC 1 cut(s) 362
SetI ASST 4 cut(s) 63, 70, 81, 262
SgeI CNNG 8 cut(s) 38, 86, 127, 169, 223, 298, 319, 371
SinI GGWCC 1 cut(s) 362
SsiI CCGC 2 cut(s) 114, 150
SspMI CTAG 1 cut(s) 379
TscAI CASTG 1 cut(s) 58
TseFI GTSAC 1 cut(s) 74
Tsp45I GTSAC 1 cut(s) 74
TspGWI ACGGA 6 cut(s) 183, 192, 216, 246, 270, 291
TspRI CASTG 1 cut(s) 58
VpaK11BI GGWCC 1 cut(s) 362
XspI CTAG 1 cut(s) 379
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.