Rmu_co7998732.1_g000001

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co7998732.1
OG0000866
Physical Location & Seq
Reverse (-)
13 .. 407
395 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co7998732.1_g000001.1.cds

Sequence Viewer

Length: 285 bp
atggcattctcaaagacttttcttcttgtcgcccttgcctttgctgttctcctcatctctgctgaggtctcggctcatcgtgacctagctgaggctaccactactactcaaaaagccaacactgacggttaccacggcggaggatatggacatggaggcggaggatatggacatggaggacatggaggcggaggatatggacatggaggacatggtggacacggaggacacggaggacatggaggacatggacctcatgctgttgagactgaaactgagaactag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

94

Amino Acids

9.2

Weight (kDa)

6.27

Isoelectric Point (pI)

16.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 138, 159, 189
AfiI CCNNNNNNNGG 1 cut(s) 91
AluBI AGCT 1 cut(s) 89
AluI AGCT 1 cut(s) 89
Alw26I GTCTC 2 cut(s) 73, 260
AspS9I GGNCC 1 cut(s) 251
AvaII GGWCC 1 cut(s) 251
BbvCI CCTCAGC 2 cut(s) 63, 90
BceAI ACGGC 1 cut(s) 151
BcoDI GTCTC 2 cut(s) 73, 260
BfaI CTAG 2 cut(s) 86, 283
Bme18I GGWCC 1 cut(s) 251
BmgT120I GGNCC 1 cut(s) 251
Bpu10I CCTNAGC 2 cut(s) 63, 90
BsaI GGTCTC 1 cut(s) 73
BsaJI CCNNGG 1 cut(s) 133
Bsc4I CCNNNNNNNGG 1 cut(s) 91
BseDI CCNNGG 1 cut(s) 133
BseLI CCNNNNNNNGG 1 cut(s) 91
BseMII CTCAG 3 cut(s) 54, 81, 267
BseRI GAGGAG 1 cut(s) 41
BslI CCNNNNNNNGG 1 cut(s) 91
BsmAI GTCTC 2 cut(s) 73, 260
BsmI GAATGC 1 cut(s) 5
Bso31I GGTCTC 1 cut(s) 73
BspACI CCGC 3 cut(s) 138, 159, 189
BspCNI CTCAG 3 cut(s) 55, 82, 268
BspTNI GGTCTC 1 cut(s) 73
BssECI CCNNGG 1 cut(s) 133
Bst4CI ACNGT 1 cut(s) 128
BstDEI CTNAG 3 cut(s) 63, 90, 276
BstDSI CCRYGG 1 cut(s) 133
BstEII GGTNACC 1 cut(s) 128
BstENI CCTNNNNNAGG 1 cut(s) 89
BstMAI GTCTC 2 cut(s) 73, 260
BstPI GGTNACC 1 cut(s) 128
BtgI CCRYGG 1 cut(s) 133
BtsIMutI CAGTG 1 cut(s) 120
Cfr13I GGNCC 1 cut(s) 251
CviAII CATG 8 cut(s) 152, 173, 182, 203, 212, 239, 248, 257
CviJI RGCY 4 cut(s) 74, 89, 95, 116
CviKI_1 RGCY 4 cut(s) 74, 89, 95, 116
DdeI CTNAG 3 cut(s) 63, 90, 276
EciI GGCGGA 3 cut(s) 153, 174, 204
Eco31I GGTCTC 1 cut(s) 73
Eco47I GGWCC 1 cut(s) 251
Eco91I GGTNACC 1 cut(s) 128
EcoNI CCTNNNNNAGG 1 cut(s) 89
EcoO65I GGTNACC 1 cut(s) 128
FaeI CATG 8 cut(s) 155, 176, 185, 206, 215, 242, 251, 260
FatI CATG 8 cut(s) 151, 172, 181, 202, 211, 238, 247, 256
FspBI CTAG 2 cut(s) 86, 283
Hin1II CATG 8 cut(s) 155, 176, 185, 206, 215, 242, 251, 260
Hpy166II GTNNAC 1 cut(s) 218
Hpy188III TCNNGA 1 cut(s) 80
Hpy8I GTNNAC 1 cut(s) 218
HpyCH4III ACNGT 1 cut(s) 128
HpyF3I CTNAG 3 cut(s) 63, 90, 276
Hsp92II CATG 8 cut(s) 155, 176, 185, 206, 215, 242, 251, 260
MaeI CTAG 2 cut(s) 86, 283
MaeIII GTNAC 2 cut(s) 80, 128
MboII GAAGA 1 cut(s) 14
Mva1269I GAATGC 1 cut(s) 5
NlaIII CATG 8 cut(s) 155, 176, 185, 206, 215, 242, 251, 260
NmeAIII GCCGAG 1 cut(s) 50
NmuCI GTSAC 1 cut(s) 80
PctI GAATGC 1 cut(s) 5
PspEI GGTNACC 1 cut(s) 128
PspPI GGNCC 1 cut(s) 251
Sau96I GGNCC 1 cut(s) 251
SetI ASST 4 cut(s) 69, 87, 91, 256
SinI GGWCC 1 cut(s) 251
SsiI CCGC 3 cut(s) 138, 159, 189
SspMI CTAG 2 cut(s) 86, 283
TaaI ACNGT 1 cut(s) 128
TscAI CASTG 1 cut(s) 127
TseFI GTSAC 1 cut(s) 80
Tsp45I GTSAC 1 cut(s) 80
TspGWI ACGGA 2 cut(s) 237, 246
TspRI CASTG 1 cut(s) 127
VpaK11BI GGWCC 1 cut(s) 251
XagI CCTNNNNNAGG 1 cut(s) 89
XspI CTAG 2 cut(s) 86, 283
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.